header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-101102-5
Morpholino Name: MO6-fsta
Target: fsta (1)
Previous Name: fsta-MO2 E3I3 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGTGTTACCTACTTTTGCATTTGCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking morpholino targeted to exon3-intron3 junction (E3I3)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO6-fsta No data available
GENE EXPRESSION
Gene expression in Wild Types + MO6-fsta No data available
PHENOTYPE
Phenotype resulting from MO6-fsta
No data available

Phenotype of all Fish created by or utilizing MO6-fsta
Phenotype Fish Conditions Figures
otic vesicle formation process quality, abnormal WT + MO1-chrd + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic vesicle decreased size, abnormal WT + MO1-chrd + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic placode formation process quality, abnormal WT + MO1-chrd + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic vesicle formation process quality, abnormal fgf8ati282a/ti282a + MO1-chrd + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic placode formation process quality, abnormal fgf8ati282a/ti282a + MO1-chrd + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic vesicle malformed, abnormal WT + MO1-chrd + MO2-bmper + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic vesicle formation process quality, abnormal WT + MO1-chrd + MO2-bmper + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic placode formation process quality, abnormal WT + MO1-chrd + MO2-bmper + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic vesicle decreased size, abnormal WT + MO1-chrd + MO2-bmper + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
trigeminal placode decreased size, abnormal WT + MO1-chrd + MO2-bmper + MO6-fsta standard conditions Fig. 3 with image from Kwon et al., 2009
inner ear lacks all parts of type otolith, abnormal WT + MO1-chrd + MO2-bmper + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic vesicle formation process quality, abnormal fgf8ati282a/ti282a + MO1-chrd + MO2-bmper + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic placode formation process quality, abnormal fgf8ati282a/ti282a + MO1-chrd + MO2-bmper + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic vesicle aplastic, abnormal fgf8ati282a/ti282a + MO1-chrd + MO2-bmper + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
OTHER MO6-fsta MORPHOLINO PAGESNo links to external sites
CITATIONS (1)