Morpholino

MO3-ptpn11a

ID
ZDB-MRPHLNO-101026-4
Name
MO3-ptpn11a
Previous Names
  • MO3-ptpn11
  • Shp2 ATG-MO (1)
Target
Sequence
5' - GTGGAACCACCTTCGGGATGTCATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets start site
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-ptpn11a
Expressed Gene Anatomy Figures
crestin Fig. 3 with image from Stewart et al., 2010
dlx2a Fig. 3 with image from Stewart et al., 2010
foxd3 Fig. 2 with image from Stewart et al., 2010
sox10 Fig. 2 with image from Stewart et al., 2010
th Fig. S1 with image from Stewart et al., 2010
tuba8l3 Fig. 3 with image from Stewart et al., 2010
Phenotype
Phenotype resulting from MO3-ptpn11a
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO3-ptpn11a Fig. 3 with image from Stewart et al., 2010
convergent extension disrupted, abnormal WT + MO3-ptpn11a Fig. 1 with image from Stewart et al., 2010
dorsal root ganglion neuron decreased amount, abnormal WT + MO3-ptpn11a Fig. S1 with image from Stewart et al., 2010
dorsal root ganglion neuron displaced, abnormal WT + MO3-ptpn11a Fig. S1 with image from Stewart et al., 2010
enteric nervous system neuron decreased amount, abnormal WT + MO3-ptpn11a Fig. S1 with image from Stewart et al., 2010
epibranchial ganglion decreased amount, abnormal WT + MO3-ptpn11a Fig. S1 with image from Stewart et al., 2010
melanocyte decreased amount, abnormal WT + MO3-ptpn11a Fig. 1 with image from Stewart et al., 2010
melanocyte mislocalised, abnormal WT + MO3-ptpn11a Fig. 1 with image from Stewart et al., 2010
neural crest cell migration delayed, abnormal WT + MO3-ptpn11a Fig. 2 with image from Stewart et al., 2010
neural crest cell migration process quality, abnormal WT + MO3-ptpn11a Fig. 2 with image from Stewart et al., 2010
pharyngeal arch 1 displaced, abnormal WT + MO3-ptpn11a Fig. 1 with image from Stewart et al., 2010
pharyngeal arch 1 structure, abnormal WT + MO3-ptpn11a Fig. 1 with image from Stewart et al., 2010
pharyngeal arch 2 displaced, abnormal WT + MO3-ptpn11a Fig. 1 with image from Stewart et al., 2010
pharyngeal arch 2 structure, abnormal WT + MO3-ptpn11a Fig. 1 with image from Stewart et al., 2010
pharyngeal arch 3-7 aplastic, abnormal WT + MO3-ptpn11a Fig. 1 with image from Stewart et al., 2010
posterior lateral line neuron decreased amount, abnormal WT + MO3-ptpn11a Fig. S1 with image from Stewart et al., 2010
sympathetic nervous system neuron decreased amount, abnormal WT + MO3-ptpn11a Fig. S1 with image from Stewart et al., 2010
trigeminal ganglion decreased amount, abnormal WT + MO3-ptpn11a Fig. S1 with image from Stewart et al., 2010
Phenotype of all Fish created by or utilizing MO3-ptpn11a
Phenotype Fish Conditions Figures
convergent extension disrupted, abnormal WT + MO3-ptpn11a standard conditions Fig. 1 with image from Stewart et al., 2010
pharyngeal arch 3-7 aplastic, abnormal WT + MO3-ptpn11a standard conditions Fig. 1 with image from Stewart et al., 2010
enteric nervous system neuron decreased amount, abnormal WT + MO3-ptpn11a standard conditions Fig. S1 with image from Stewart et al., 2010
apoptotic process increased occurrence, abnormal WT + MO3-ptpn11a standard conditions Fig. 3 with image from Stewart et al., 2010
neural crest cell migration process quality, abnormal WT + MO3-ptpn11a standard conditions Fig. 2 with image from Stewart et al., 2010
pharyngeal arch 1 displaced, abnormal WT + MO3-ptpn11a standard conditions Fig. 1 with image from Stewart et al., 2010
dorsal root ganglion neuron displaced, abnormal WT + MO3-ptpn11a standard conditions Fig. S1 with image from Stewart et al., 2010
pharyngeal arch 2 displaced, abnormal WT + MO3-ptpn11a standard conditions Fig. 1 with image from Stewart et al., 2010
dorsal root ganglion neuron decreased amount, abnormal WT + MO3-ptpn11a standard conditions Fig. S1 with image from Stewart et al., 2010
epibranchial ganglion decreased amount, abnormal WT + MO3-ptpn11a standard conditions Fig. S1 with image from Stewart et al., 2010
posterior lateral line neuron decreased amount, abnormal WT + MO3-ptpn11a standard conditions Fig. S1 with image from Stewart et al., 2010
melanocyte mislocalised, abnormal WT + MO3-ptpn11a standard conditions Fig. 1 with image from Stewart et al., 2010
pharyngeal arch 2 structure, abnormal WT + MO3-ptpn11a standard conditions Fig. 1 with image from Stewart et al., 2010
melanocyte decreased amount, abnormal WT + MO3-ptpn11a standard conditions Fig. 1 with image from Stewart et al., 2010
trigeminal ganglion decreased amount, abnormal WT + MO3-ptpn11a standard conditions Fig. S1 with image from Stewart et al., 2010
sympathetic nervous system neuron decreased amount, abnormal WT + MO3-ptpn11a standard conditions Fig. S1 with image from Stewart et al., 2010
pharyngeal arch 1 structure, abnormal WT + MO3-ptpn11a standard conditions Fig. 1 with image from Stewart et al., 2010
neural crest cell migration delayed, abnormal WT + MO3-ptpn11a standard conditions Fig. 2 with image from Stewart et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.