ZFIN ID: ZDB-MRPHLNO-100908-9
Morpholino Name: MO3-msna
Target: msna (1)
Sequence:
5' - ACGAATGTGTCACAAACTGAAGCTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets 5'UTR.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-msna No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-msna No data available
PHENOTYPE
Phenotype resulting from MO3-msna
No data available

Phenotype of all Fish created by or utilizing MO3-msna
No data available
OTHER MO3-msna MORPHOLINO PAGESNo links to external sites
CITATIONS (1)