Morpholino

MO1-pdgfrb

ID

ZDB-MRPHLNO-100806-7

Name

MO1-pdgfrb

Previous Names

Target

Sequence

5' - ACAGGAACTGAAGTCACTGACCTTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-pdgfrb

Expressed Gene	Anatomy	Figures
cdh5	vascular endothelium	Fig. 4 from Damm et al., 2017
efnb2a	dorsal aorta	Fig. 4 from Damm et al., 2017
gata1a	erythroid progenitor cell	Fig. 4 from Damm et al., 2017
gata2b	hematopoietic system	Fig. 4 from Damm et al., 2017
myb	ventral wall of dorsal aorta hematopoietic stem cell	Fig. 2 from Lim et al., 2017
notch1b	dorsal aorta	Fig. 4 from Damm et al., 2017
runx1	ventral wall of dorsal aorta hematopoietic stem cell	Fig. 2 from Lim et al., 2017
tal1	hematopoietic system	Fig. 4 from Damm et al., 2017

Phenotype

Phenotype resulting from MO1-pdgfrb

Phenotype	Fish	Figures
intersegmental vessel decreased amount, abnormal	s843Tg + MO1-pdgfrb	Fig. 5 from Wiens et al., 2010

Phenotype of all Fish created by or utilizing MO1-pdgfrb

Phenotype	Fish	Conditions	Figures
ventral wall of dorsal aorta hematopoietic stem cell myb expression amount, ameliorated	WT + MO1-pdgfrb	chemical treatment by environment: dimethyloxalylglycine	Fig. 2 from Lim et al., 2017
ventral wall of dorsal aorta hematopoietic stem cell runx1 expression amount, ameliorated	WT + MO1-pdgfrb	chemical treatment by environment: dimethyloxalylglycine	Fig. 2 from Lim et al., 2017
intersegmental vessel decreased amount, abnormal	s843Tg + MO1-pdgfrb	standard conditions	Fig. 5 from Wiens et al., 2010
ventral wall of dorsal aorta hematopoietic stem cell runx1 expression amount, ameliorated	WT + MO1-pdgfrb + MO2-vhl	control	Fig. 2 from Lim et al., 2017
ventral wall of dorsal aorta hematopoietic stem cell myb expression amount, ameliorated	WT + MO1-pdgfrb + MO2-vhl	control	Fig. 2 from Lim et al., 2017
brain hemorrhagic, abnormal	WT + MO1-foxc1b + MO1-pdgfrb + MO2-foxc1a	standard conditions	Fig. 2 from French et al., 2014
brain hemorrhagic, abnormal	WT + MO1-foxc1b + MO1-pdgfrb + MO2-foxc1a + MO2-pdgfra	standard conditions	Fig. 2 from French et al., 2014
neural crest cell migration delayed, abnormal	zf566Tg + MO1-pdgfrb + MO2-pdgfra	standard conditions	Fig. S4 from French et al., 2014
hematopoietic multipotent progenitor cell decreased amount, ameliorated	la2Tg; sd2Tg + MO1-pdgfrb + MO2-vhl	standard conditions	Fig. 2 from Lim et al., 2017

Citations