Morpholino

MO2-tbx1

ID
ZDB-MRPHLNO-100715-1
Name
MO2-tbx1
Previous Names
None
Target
Sequence
5' - ATTGGATTTACAATTTGCGCTGGAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tbx1
Phenotype
Phenotype resulting from MO2-tbx1
Phenotype Fish Figures
aortic arch decreased amount, abnormal AB + MO2-tbx1 Fig. 1 from Zhang et al., 2010
atrium decreased size, abnormal AB + MO2-tbx1 Fig. 5 from Zhang et al., 2010
blood circulation disrupted, abnormal AB + MO2-tbx1 Fig. 5 from Zhang et al., 2010
cardiac ventricle decreased size, abnormal AB + MO2-tbx1 Fig. 5 from Zhang et al., 2010
ceratobranchial cartilage aplastic, abnormal AB + MO2-tbx1 Fig. 2 from Zhang et al., 2010
heart decreased contractility, abnormal AB + MO2-tbx1 Fig. 4 from Zhang et al., 2010
heart symmetry, abnormal AB + MO2-tbx1 Fig. 5 from Zhang et al., 2010
heart contraction decreased rate, abnormal AB + MO2-tbx1 Fig. 4 from Zhang et al., 2010
heart development disrupted, abnormal AB + MO2-tbx1 Fig. 5 from Zhang et al., 2010
heart looping disrupted, abnormal AB + MO2-tbx1 Fig. 5 from Zhang et al., 2010
hindbrain neural crest cell decreased amount, abnormal AB + MO2-tbx1 Fig. 2 from Zhang et al., 2010
macula hypoplastic, abnormal AB + MO2-tbx1 Fig. 1 from Zhang et al., 2010
Meckel's cartilage decreased size, abnormal AB + MO2-tbx1 Fig. 2 from Zhang et al., 2010
midbrain neural crest cell decreased amount, abnormal AB + MO2-tbx1 Fig. 2 from Zhang et al., 2010
otic vesicle decreased size, abnormal AB + MO2-tbx1 Fig. 1 from Zhang et al., 2010
pharyngeal arch 1 neural crest cell decreased amount, abnormal AB + MO2-tbx1 Fig. 3 from Zhang et al., 2010
pharyngeal arch 1 neural crest cell present, abnormal AB + MO2-tbx1 Fig. 3 from Zhang et al., 2010
pharyngeal arch 2 neural crest cell absent, abnormal AB + MO2-tbx1 Fig. 3 from Zhang et al., 2010
pharyngeal arch 2 neural crest cell decreased amount, abnormal AB + MO2-tbx1 Fig. 3 from Zhang et al., 2010
pharyngeal arch 2 skeleton decreased size, abnormal AB + MO2-tbx1 Fig. 2 from Zhang et al., 2010
pharyngeal arch 3-7 neural crest cell absent, abnormal AB + MO2-tbx1 Fig. 2Fig. 3 from Zhang et al., 2010
semicircular canal hypoplastic, abnormal AB + MO2-tbx1 Fig. 1 from Zhang et al., 2010
thymus aplastic, abnormal AB + MO2-tbx1 Fig. 1 from Zhang et al., 2010
thymus hypoplastic, abnormal AB + MO2-tbx1 Fig. 1 from Zhang et al., 2010
Phenotype of all Fish created by or utilizing MO2-tbx1
Phenotype Fish Conditions Figures
pharyngeal arch 2 neural crest cell absent, abnormal AB + MO2-tbx1 standard conditions Fig. 3 from Zhang et al., 2010
pharyngeal arch 3-7 neural crest cell absent, abnormal AB + MO2-tbx1 standard conditions Fig. 2Fig. 3 from Zhang et al., 2010
semicircular canal hypoplastic, abnormal AB + MO2-tbx1 standard conditions Fig. 1 from Zhang et al., 2010
ceratobranchial cartilage aplastic, abnormal AB + MO2-tbx1 standard conditions Fig. 2 from Zhang et al., 2010
hindbrain neural crest cell decreased amount, abnormal AB + MO2-tbx1 standard conditions Fig. 2 from Zhang et al., 2010
heart looping disrupted, abnormal AB + MO2-tbx1 standard conditions Fig. 5 from Zhang et al., 2010
pharyngeal arch 1 neural crest cell decreased amount, abnormal AB + MO2-tbx1 standard conditions Fig. 3 from Zhang et al., 2010
heart decreased contractility, abnormal AB + MO2-tbx1 standard conditions Fig. 4 from Zhang et al., 2010
thymus aplastic, abnormal AB + MO2-tbx1 standard conditions Fig. 1 from Zhang et al., 2010
heart symmetry, abnormal AB + MO2-tbx1 standard conditions Fig. 5 from Zhang et al., 2010
otic vesicle decreased size, abnormal AB + MO2-tbx1 standard conditions Fig. 1 from Zhang et al., 2010
blood circulation disrupted, abnormal AB + MO2-tbx1 standard conditions Fig. 5 from Zhang et al., 2010
pharyngeal arch 2 skeleton decreased size, abnormal AB + MO2-tbx1 standard conditions Fig. 2 from Zhang et al., 2010
cardiac ventricle decreased size, abnormal AB + MO2-tbx1 standard conditions Fig. 5 from Zhang et al., 2010
heart contraction decreased rate, abnormal AB + MO2-tbx1 standard conditions Fig. 4 from Zhang et al., 2010
Meckel's cartilage decreased size, abnormal AB + MO2-tbx1 standard conditions Fig. 2 from Zhang et al., 2010
midbrain neural crest cell decreased amount, abnormal AB + MO2-tbx1 standard conditions Fig. 2 from Zhang et al., 2010
thymus hypoplastic, abnormal AB + MO2-tbx1 standard conditions Fig. 1 from Zhang et al., 2010
atrium decreased size, abnormal AB + MO2-tbx1 standard conditions Fig. 5 from Zhang et al., 2010
macula hypoplastic, abnormal AB + MO2-tbx1 standard conditions Fig. 1 from Zhang et al., 2010
pharyngeal arch 1 neural crest cell present, abnormal AB + MO2-tbx1 standard conditions Fig. 3 from Zhang et al., 2010
pharyngeal arch 2 neural crest cell decreased amount, abnormal AB + MO2-tbx1 standard conditions Fig. 3 from Zhang et al., 2010
heart development disrupted, abnormal AB + MO2-tbx1 standard conditions Fig. 5 from Zhang et al., 2010
aortic arch decreased amount, abnormal AB + MO2-tbx1 standard conditions Fig. 1 from Zhang et al., 2010
Citations