Morpholino

MO1-add3a

ID
ZDB-MRPHLNO-100622-8
Name
MO1-add3a
Previous Names
  • add3TP (1)
  • target protector morpholino (add3a tp) (1)
Target
Sequence
5' - ACATGAGAGATGAGTGGTAGATAGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This MO targets the miR-143 binding site within the 3 'UTR of the add3a gene. As a result, this MO up-regulates levels of the add3a gene product in structures where endogenous miR-143 normally down-regulates add3a, such as in the developing heart ( Deacon et al. ZDB-PUB-100518-4 ).
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-add3a
Expressed Gene Anatomy Figures
alcama Fig. 5 with image,  Fig. 7 with image from Deacon et al., 2010
Phenotype
Phenotype resulting from MO1-add3a
Phenotype Fish Figures
atrium dilated, abnormal f1Tg + MO1-add3a Fig. 5 with image from Deacon et al., 2010
cardiac ventricle decreased contractility, abnormal f1Tg + MO1-add3a Fig. 5 with image from Deacon et al., 2010
cardiac ventricle malformed, abnormal f1Tg + MO1-add3a Fig. 5 with image from Deacon et al., 2010
cardiac ventricle cardiac muscle cell circular, abnormal f1Tg + MO1-add3a Fig. 5 with image from Deacon et al., 2010
cardiac ventricle cardiac muscle cell decreased size, abnormal f1Tg + MO1-add3a Fig. 5 with image from Deacon et al., 2010
embryonic heart tube morphogenesis decreased process quality, abnormal f1Tg + MO1-add3a Fig. 5 with image from Deacon et al., 2010
regulation of actin cytoskeleton organization decreased process quality, abnormal WT + MO1-add3a Fig. 7 with image from Deacon et al., 2010
ventricular myocardium filamentous actin mislocalised, abnormal WT + MO1-add3a Fig. 7 with image from Deacon et al., 2010
Phenotype of all Fish created by or utilizing MO1-add3a
Phenotype Fish Conditions Figures
ventricular myocardium filamentous actin mislocalised, abnormal WT + MO1-add3a standard conditions Fig. 7 with image from Deacon et al., 2010
regulation of actin cytoskeleton organization decreased process quality, abnormal WT + MO1-add3a standard conditions Fig. 7 with image from Deacon et al., 2010
cardiac ventricle malformed, abnormal f1Tg + MO1-add3a standard conditions Fig. 5 with image from Deacon et al., 2010
cardiac ventricle cardiac muscle cell decreased size, abnormal f1Tg + MO1-add3a standard conditions Fig. 5 with image from Deacon et al., 2010
atrium dilated, abnormal f1Tg + MO1-add3a standard conditions Fig. 5 with image from Deacon et al., 2010
cardiac ventricle cardiac muscle cell circular, abnormal f1Tg + MO1-add3a standard conditions Fig. 5 with image from Deacon et al., 2010
cardiac ventricle decreased contractility, abnormal f1Tg + MO1-add3a standard conditions Fig. 5 with image from Deacon et al., 2010
embryonic heart tube morphogenesis decreased process quality, abnormal f1Tg + MO1-add3a standard conditions Fig. 5 with image from Deacon et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.