Morpholino

MO2-chrdl2

ID
ZDB-MRPHLNO-100607-1
Name
MO2-chrdl2
Previous Names
  • 5'1-MO (1)
Target
Sequence
5' - AAAAACTGGAGACGCAGGATTTGTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets 5' UTR of chrdl2.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-chrdl2
Expressed Gene Anatomy Figures
chrd Fig. 7 with image from Branam et al., 2010
gata2a Fig. 7 with image from Branam et al., 2010
Phenotype
Phenotype resulting from MO2-chrdl2
Phenotype Fish Figures
dorsal/ventral pattern formation disrupted, abnormal WT + MO2-chrdl2 Fig. 7 with image from Branam et al., 2010
embryo development arrested, abnormal WT + MO2-chrdl2 text only from Branam et al., 2010
eye decreased size, abnormal WT + MO2-chrdl2 Fig. 6 with image from Branam et al., 2010
head decreased size, abnormal WT + MO2-chrdl2 Fig. 6 with image from Branam et al., 2010
post-vent region bent, abnormal WT + MO2-chrdl2 + MO4-tp53 Fig. 8 with image from Branam et al., 2010
post-vent region curved, abnormal WT + MO2-chrdl2 Fig. 7 with image from Branam et al., 2010
post-vent region truncated, abnormal WT + MO2-chrdl2 Fig. 6 with image from Branam et al., 2010
whole organism broken, abnormal WT + MO2-chrdl2 text only from Branam et al., 2010
whole organism decreased length, abnormal WT + MO2-chrdl2 Fig. 6 with image from Branam et al., 2010
whole organism wholly ventralized, abnormal WT + MO2-chrdl2 Fig. 7 with image from Branam et al., 2010
yolk increased size, abnormal WT + MO2-chrdl2 + MO4-tp53 Fig. 6 with image from Branam et al., 2010
Phenotype of all Fish created by or utilizing MO2-chrdl2
Phenotype Fish Conditions Figures
yolk increased size, abnormal WT + MO2-chrdl2 standard conditions Fig. 6 with image from Branam et al., 2010
embryo development arrested, abnormal WT + MO2-chrdl2 standard conditions text only from Branam et al., 2010
post-vent region curved, abnormal WT + MO2-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
whole organism wholly ventralized, abnormal WT + MO2-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
eye decreased size, abnormal WT + MO2-chrdl2 standard conditions Fig. 6 with image from Branam et al., 2010
whole organism broken, abnormal WT + MO2-chrdl2 standard conditions text only from Branam et al., 2010
dorsal/ventral pattern formation disrupted, abnormal WT + MO2-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
head decreased size, abnormal WT + MO2-chrdl2 standard conditions Fig. 6 with image from Branam et al., 2010
post-vent region bent, abnormal WT + MO2-chrdl2 standard conditions Fig. 8 with image from Branam et al., 2010
post-vent region truncated, abnormal WT + MO2-chrdl2 standard conditions Fig. 6 with image from Branam et al., 2010
whole organism decreased length, abnormal WT + MO2-chrdl2 standard conditions Fig. 6 with image from Branam et al., 2010
post-vent region truncated, abnormal WT + MO2-chrdl2 + MO4-tp53 standard conditions Fig. 6 with image from Branam et al., 2010
head decreased size, abnormal WT + MO2-chrdl2 + MO4-tp53 standard conditions Fig. 6 with image from Branam et al., 2010
eye decreased size, abnormal WT + MO2-chrdl2 + MO4-tp53 standard conditions Fig. 6 with image from Branam et al., 2010
post-vent region bent, abnormal WT + MO2-chrdl2 + MO4-tp53 standard conditions Fig. 8 with image from Branam et al., 2010
yolk increased size, abnormal WT + MO2-chrdl2 + MO4-tp53 standard conditions Fig. 6 with image from Branam et al., 2010
whole organism decreased length, abnormal WT + MO2-chrdl2 + MO4-tp53 standard conditions Fig. 6 with image from Branam et al., 2010
head morphology, abnormal WT + MO1-chrd + MO2-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
post-vent region increased thickness, abnormal WT + MO1-chrd + MO2-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
head decreased size, abnormal WT + MO1-chrd + MO2-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
blood circulation disrupted, abnormal WT + MO1-chrd + MO2-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO2-chrdl2 standard conditions Fig. 7 with image,  Fig. 8 with image from Branam et al., 2010
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-chrd + MO2-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-chrd + MO2-chrdl2 + MO4-tp53 standard conditions Fig. 8 with image from Branam et al., 2010
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO2-chrdl2 + MO4-tp53 standard conditions Fig. 8 with image from Branam et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.