Morpholino

MO2-hmx3a

ID

ZDB-MRPHLNO-100602-4

Name

MO2-hmx3a

Previous Names

None

Target

hmx3a (1)

Sequence

5' - CATGTTGGCTTGATATTCGGGTTTA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-hmx3a

No data available

Phenotype

Phenotype resulting from MO2-hmx3a

Phenotype	Fish	Figures
otolith fused with otolith, abnormal	AB + MO2-hmx3a	text only from Feng et al., 2010
posterior lateral line neuromast decreased amount, abnormal	AB + MO2-hmx3a	text only from Feng et al., 2010
whole organism balance, abnormal	AB + MO2-hmx3a	text only from Feng et al., 2010
whole organism decreased coordination, abnormal	AB + MO2-hmx3a	text only from Feng et al., 2010

Phenotype of all Fish created by or utilizing MO2-hmx3a

Phenotype	Fish	Conditions	Figures
whole organism balance, abnormal	AB + MO2-hmx3a	standard conditions	text only from Feng et al., 2010
whole organism decreased coordination, abnormal	AB + MO2-hmx3a	standard conditions	text only from Feng et al., 2010
posterior lateral line neuromast decreased amount, abnormal	AB + MO2-hmx3a	standard conditions	text only from Feng et al., 2010
otolith fused with otolith, abnormal	AB + MO2-hmx3a	standard conditions	text only from Feng et al., 2010
lapillus fused with sagitta, abnormal	AB + MO1-hmx2 + MO2-hmx3a	standard conditions	Fig. 2 from Feng et al., 2010
posterior lateral line neuromast decreased amount, abnormal	AB + MO1-hmx2 + MO2-hmx3a	standard conditions	Fig. 6 , text only from Feng et al., 2010
lapillus mislocalised, abnormal	AB + MO1-hmx2 + MO2-hmx3a	standard conditions	Fig. 2 from Feng et al., 2010
hair cell anterior macula decreased amount, abnormal	AB + MO1-hmx2 + MO2-hmx3a	standard conditions	Fig. 3 from Feng et al., 2010
macula neuromast hair cell decreased amount, abnormal	AB + MO1-hmx2 + MO2-hmx3a	standard conditions	Fig. 3 from Feng et al., 2010
startle response disrupted, abnormal	AB + MO1-hmx2 + MO2-hmx3a	standard conditions	Fig. 2 from Feng et al., 2010
otolith located in saccule, abnormal	AB + MO1-hmx2 + MO2-hmx3a	standard conditions	Fig. 2 from Feng et al., 2010
semicircular canal decreased size, abnormal	AB + MO1-hmx2 + MO2-hmx3a	standard conditions	Fig. 2 from Feng et al., 2010
vestibular reflex disrupted, abnormal	AB + MO1-hmx2 + MO2-hmx3a	standard conditions	Fig. 2 from Feng et al., 2010
neuromuscular process controlling balance disrupted, abnormal	AB + MO1-hmx2 + MO2-hmx3a	standard conditions	Fig. 2 from Feng et al., 2010
posterior lateral line neuromast absent, abnormal	AB + MO1-hmx2 + MO2-hmx3a	standard conditions	Fig. 2 , Fig. 6 , text only from Feng et al., 2010
anterior macula mislocalised posteriorly, abnormal	AB + MO1-hmx2 + MO2-hmx3a	standard conditions	Fig. 3 from Feng et al., 2010
inner ear decreased size, abnormal	AB + MO1-hmx2 + MO2-hmx3a	standard conditions	Fig. 2 from Feng et al., 2010
anterior macula fused with posterior macula, abnormal	AB + MO1-hmx2 + MO2-hmx3a	standard conditions	Fig. 3 from Feng et al., 2010

Citations