ZFIN ID: ZDB-MRPHLNO-100602-1
Morpholino Name: MO1-hmx2
Target: hmx2 (1)
Sequence:
5' - CACCTGCAACCAATGCGACACACAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-hmx2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-hmx2 No data available
PHENOTYPE
Phenotype resulting from MO1-hmx2
Phenotype Figures
otolith fused with otolith, abnormal text only from Feng et al., 2010
posterior lateral line neuromast decreased amount, abnormal text only from Feng et al., 2010
whole organism balance, abnormal text only from Feng et al., 2010
whole organism decreased coordination, abnormal text only from Feng et al., 2010

Phenotype of all Fish created by or utilizing MO1-hmx2
Phenotype Fish Conditions Figures
whole organism balance, abnormal AB + MO1-hmx2 standard conditions text only from Feng et al., 2010
whole organism decreased coordination, abnormal AB + MO1-hmx2 standard conditions text only from Feng et al., 2010
otolith fused with otolith, abnormal AB + MO1-hmx2 standard conditions text only from Feng et al., 2010
posterior lateral line neuromast decreased amount, abnormal AB + MO1-hmx2 standard conditions text only from Feng et al., 2010
lapillus fused with sagitta, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 2 with image from Feng et al., 2010
posterior lateral line neuromast decreased amount, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 6 with imagetext only from Feng et al., 2010
lapillus mislocalised, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 2 with image from Feng et al., 2010
hair cell anterior macula decreased amount, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 3 with image from Feng et al., 2010
macula neuromast hair cell decreased amount, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 3 with image from Feng et al., 2010
startle response disrupted, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 2 with image from Feng et al., 2010
otolith located in saccule, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 2 with image from Feng et al., 2010
semicircular canal decreased size, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 2 with image from Feng et al., 2010
vestibular reflex disrupted, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 2 with image from Feng et al., 2010
neuromuscular process controlling balance disrupted, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 2 with image from Feng et al., 2010
posterior lateral line neuromast absent, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 2 with imageFig. 6 with imagetext only from Feng et al., 2010
anterior macula mislocalised posteriorly, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 3 with image from Feng et al., 2010
inner ear decreased size, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 2 with image from Feng et al., 2010
anterior macula fused with posterior macula, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 3 with image from Feng et al., 2010
OTHER MO1-hmx2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)