ZFIN ID: ZDB-MRPHLNO-100524-10
Morpholino Name: MO2-ehmt2
Target: ehmt2 (1)
Previous Name: g9a MO2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGTGTAAGTTTGACCTGTACGAGCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-ehmt2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-ehmt2 No data available
PHENOTYPE
Phenotype resulting from MO2-ehmt2
No data available

Phenotype of all Fish created by or utilizing MO2-ehmt2
No data available
OTHER MO2-ehmt2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)