header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100520-4
Morpholino Name: MO1-lrrk2
Target: lrrk2 (1)
Previous Name: MO51EI (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CACAAGCAGATTTATTAACCTGTGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: splice-blocking MO targeted to intron 45 splice donor junction, designed to delete exon 45, introducing a premature stop codon in the WD40 domain.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-lrrk2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-lrrk2 No data available
PHENOTYPE
Phenotype resulting from MO1-lrrk2
No data available

Phenotype of all Fish created by or utilizing MO1-lrrk2
OTHER MO1-lrrk2 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)