Morpholino

MO5-cdh5

ID
ZDB-MRPHLNO-100520-10
Name
MO5-cdh5
Previous Names
None
Target
Sequence
5' - CCTCCTGGCACACTGTTTCATCATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-cdh5
Expressed Gene Anatomy Figures
myh7 Fig. 4 with image from Mitchell et al., 2010
myl7 Fig. 4 with image from Mitchell et al., 2010
Phenotype
Phenotype resulting from MO5-cdh5
Phenotype Fish Figures
atrial endocardium structure, abnormal AB + MO5-cdh5 Fig. 5 with image,  Fig. 6 with image,  Fig. 7 with image from Mitchell et al., 2010
atrial endocardium cell-cell junction decreased amount, abnormal AB + MO5-cdh5 Fig. 7 with image from Mitchell et al., 2010
atrial endocardium cell-cell junction decreased size, abnormal AB + MO5-cdh5 Fig. 7 with image from Mitchell et al., 2010
atrial myocardium contractility, abnormal AB + MO5-cdh5 Fig. 7 with image from Mitchell et al., 2010
atrium dilated, abnormal AB + MO5-cdh5 Fig. 1 with image from Mitchell et al., 2010
atrium elongated, abnormal AB + MO5-cdh5 Fig. 5 with image from Mitchell et al., 2010
blood circulation disrupted, abnormal AB + MO5-cdh5 Fig. 1 with image,  Fig. 2 with image from Mitchell et al., 2010
cardiac jelly physical quality, abnormal AB + MO5-cdh5 Fig. 7 with image from Mitchell et al., 2010
cardiac ventricle elongated, abnormal AB + MO5-cdh5 Fig. 4 with image from Mitchell et al., 2010
heart looping disrupted, abnormal AB + MO5-cdh5 Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image from Mitchell et al., 2010
pericardium edematous, abnormal AB + MO5-cdh5 Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image,  Fig. 5 with image from Mitchell et al., 2010
sinus venosus increased accumulation blood, abnormal AB + MO5-cdh5 Fig. 1 with image from Mitchell et al., 2010
Phenotype of all Fish created by or utilizing MO5-cdh5
Phenotype Fish Conditions Figures
blood circulation disrupted, abnormal AB + MO5-cdh5 standard conditions Fig. 1 with image,  Fig. 2 with image from Mitchell et al., 2010
heart looping disrupted, abnormal AB + MO5-cdh5 standard conditions Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image from Mitchell et al., 2010
atrial endocardium structure, abnormal AB + MO5-cdh5 standard conditions Fig. 5 with image,  Fig. 7 with image from Mitchell et al., 2010
pericardium edematous, abnormal AB + MO5-cdh5 standard conditions Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image,  Fig. 5 with image from Mitchell et al., 2010
sinus venosus increased accumulation blood, abnormal AB + MO5-cdh5 standard conditions Fig. 1 with image from Mitchell et al., 2010
atrium elongated, abnormal AB + MO5-cdh5 standard conditions Fig. 5 with image from Mitchell et al., 2010
cardiac ventricle elongated, abnormal AB + MO5-cdh5 standard conditions Fig. 4 with image from Mitchell et al., 2010
atrial myocardium contractility, abnormal AB + MO5-cdh5 standard conditions Fig. 7 with image from Mitchell et al., 2010
atrial endocardium cell-cell junction decreased amount, abnormal AB + MO5-cdh5 standard conditions Fig. 7 with image from Mitchell et al., 2010
cardiac jelly physical quality, abnormal AB + MO5-cdh5 standard conditions Fig. 7 with image from Mitchell et al., 2010
atrium dilated, abnormal AB + MO5-cdh5 standard conditions Fig. 1 with image from Mitchell et al., 2010
atrial endocardium cell-cell junction decreased size, abnormal AB + MO5-cdh5 standard conditions Fig. 7 with image from Mitchell et al., 2010
atrial endocardium structure, abnormal y1Tg + MO5-cdh5 standard conditions Fig. 6 with image from Mitchell et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.