header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100511-10
Morpholino Name: MO2-cdk5
Target: cdk5 (1)
Sequence:
5' - TCCAGCTTCTCATACTTTTGCATGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-cdk5 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-cdk5
Expressed Gene Anatomy Figures
cdk5 Fig. 1 from Kanungo et al., 2009
PHENOTYPE
Phenotype resulting from MO2-cdk5
Phenotype of all Fish created by or utilizing MO2-cdk5
OTHER MO2-cdk5 MORPHOLINO PAGES No links to external sites
CITATIONS (1)