ZFIN ID: ZDB-MRPHLNO-100511-1
Morpholino Name: MO3-fgf4
Target: fgf4 (1)
Previous Name: fgf4 MO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTTCATACTCACAGATCCGTAAAGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-fgf4 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-fgf4
Expressed Gene Anatomy Figures
cp Fig. 2 with image from Yamauchi et al., 2009
fgf8a Fig. 6 with image from Yamauchi et al., 2009
foxa3 Fig. 2 with image from Yamauchi et al., 2009
lft1 Fig. 5 with image from Yamauchi et al., 2009
lft2 Fig. 5 with image from Yamauchi et al., 2009
myl7 Fig. 2 with image from Yamauchi et al., 2009
pdx1 Fig. 2 with image from Yamauchi et al., 2009
pitx2 Fig. 5 with image from Yamauchi et al., 2009
spaw Fig. 5 with image from Yamauchi et al., 2009
PHENOTYPE
Phenotype resulting from MO3-fgf4
Phenotype Figures
brain decreased size, abnormal Fig. 1 with image from Yamauchi et al., 2009
determination of heart left/right asymmetry disrupted, abnormal Fig. 2 with imageFig. 5 with image from Yamauchi et al., 2009
determination of liver left/right asymmetry disrupted, abnormal Fig. 2 with image from Yamauchi et al., 2009
determination of pancreatic left/right asymmetry disrupted, abnormal Fig. 2 with image from Yamauchi et al., 2009
heart mislocalised, abnormal Fig. 2 with image from Yamauchi et al., 2009
heart development disrupted, abnormal Fig. 5 with image from Yamauchi et al., 2009
Kupffer's vesicle motile cilium decreased length, abnormal Fig. 4 with image from Yamauchi et al., 2009
liver mislocalised, abnormal Fig. 2 with image from Yamauchi et al., 2009
pancreas mislocalised, abnormal Fig. 2 with image from Yamauchi et al., 2009
pericardium edematous, abnormal Fig. 1 with image from Yamauchi et al., 2009
trunk bent, abnormal Fig. 1 with image from Yamauchi et al., 2009

Phenotype of all Fish created by or utilizing MO3-fgf4
Phenotype Fish Conditions Figures
heart mislocalised, abnormal WT + MO3-fgf4 standard conditions Fig. 2 with image from Yamauchi et al., 2009
pancreas mislocalised, abnormal WT + MO3-fgf4 standard conditions Fig. 2 with image from Yamauchi et al., 2009
trunk bent, abnormal WT + MO3-fgf4 standard conditions Fig. 1 with image from Yamauchi et al., 2009
brain decreased size, abnormal WT + MO3-fgf4 standard conditions Fig. 1 with image from Yamauchi et al., 2009
determination of liver left/right asymmetry disrupted, abnormal WT + MO3-fgf4 standard conditions Fig. 2 with image from Yamauchi et al., 2009
Kupffer's vesicle motile cilium decreased length, abnormal WT + MO3-fgf4 standard conditions Fig. 4 with image from Yamauchi et al., 2009
determination of heart left/right asymmetry disrupted, abnormal WT + MO3-fgf4 standard conditions Fig. 2 with imageFig. 5 with image from Yamauchi et al., 2009
pericardium edematous, abnormal WT + MO3-fgf4 standard conditions Fig. 1 with image from Yamauchi et al., 2009
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO3-fgf4 standard conditions Fig. 2 with image from Yamauchi et al., 2009
heart development disrupted, abnormal WT + MO3-fgf4 standard conditions Fig. 5 with image from Yamauchi et al., 2009
liver mislocalised, abnormal WT + MO3-fgf4 standard conditions Fig. 2 with image from Yamauchi et al., 2009
pancreas mislocalised, abnormal WT + MO3-fgf4 + MO3-fgf8a standard conditions Fig. 2 with image from Yamauchi et al., 2009
liver mislocalised, abnormal WT + MO3-fgf4 + MO3-fgf8a standard conditions Fig. 2 with image from Yamauchi et al., 2009
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO3-fgf4 + MO3-fgf8a standard conditions Fig. 2 with image from Yamauchi et al., 2009
determination of liver left/right asymmetry disrupted, abnormal WT + MO3-fgf4 + MO3-fgf8a standard conditions Fig. 2 with image from Yamauchi et al., 2009
OTHER MO3-fgf4 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)