ZFIN ID: ZDB-MRPHLNO-100510-3
Morpholino Name: MO3-stat3
Target: stat3 (1)
Sequence:
5' - CAGATAAATCGTCCTCCACGGAAAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-stat3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-stat3
Expressed Gene Anatomy Figures
stat3 Fig. 4 with image from Yin et al., 2012
Fig. 5 from Kassen et al., 2009
PHENOTYPE
Phenotype resulting from MO3-stat3
Phenotype Figures
eye apoptotic, abnormal Fig. 4 with imageFig. 5 with image from Yin et al., 2012
eye decreased size, abnormal Fig. 4 with imageFig. 5 with image from Yin et al., 2012
Muller cell proliferative, abnormal Fig. 10 from Kassen et al., 2009
retinal neural layer Muller cell decreased amount, abnormal Fig. 4 with image from Yin et al., 2012
retinal photoreceptor layer retinal cone cell decreased amount, abnormal Fig. 4 with imageFig. 5 with image from Yin et al., 2012

Phenotype of all Fish created by or utilizing MO3-stat3
Phenotype Fish Conditions Figures
Muller cell proliferative, abnormal WT + MO3-stat3 standard conditions Fig. 10 from Kassen et al., 2009
retinal photoreceptor layer retinal cone cell decreased amount, abnormal WT + MO3-stat3 standard conditions Fig. 4 with image from Yin et al., 2012
eye decreased size, abnormal WT + MO3-stat3 standard conditions Fig. 4 with imageFig. 5 with image from Yin et al., 2012
retinal neural layer Muller cell decreased amount, abnormal WT + MO3-stat3 standard conditions Fig. 4 with image from Yin et al., 2012
eye apoptotic, abnormal WT + MO3-stat3 standard conditions Fig. 4 with imageFig. 5 with image from Yin et al., 2012
retinal photoreceptor layer retinal cone cell decreased amount, abnormal nt11Tg + MO3-stat3 standard conditions Fig. 5 with image from Yin et al., 2012
eye decreased size, abnormal nt11Tg + MO3-stat3 standard conditions Fig. 5 with image from Yin et al., 2012
eye decreased size, abnormal WT + MO3-stat3 + MO5-socs3a standard conditions Fig. 4 with imageFig. 5 with image from Yin et al., 2012
eye apoptotic, abnormal WT + MO3-stat3 + MO5-socs3a standard conditions Fig. 4 with imageFig. 5 with image from Yin et al., 2012
eye decreased size, abnormal nt11Tg + MO3-stat3 + MO5-socs3a standard conditions Fig. 5 with image from Yin et al., 2012
OTHER MO3-stat3 MORPHOLINO PAGESNo links to external sites
CITATIONS (4)