header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100510-3
Morpholino Name: MO3-stat3
Target: stat3 (1)
Sequence:
5' - CAGATAAATCGTCCTCCACGGAAAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-stat3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-stat3
Expressed Gene Anatomy Figures
stat3 Fig. 4 with image from Yin et al., 2012
Fig. 5 from Kassen et al., 2009
PHENOTYPE
Phenotype resulting from MO3-stat3
Phenotype of all Fish created by or utilizing MO3-stat3
OTHER MO3-stat3 MORPHOLINO PAGESNo links to external sites
CITATIONS (4)