ZFIN ID: ZDB-MRPHLNO-100510-12
Morpholino Name: MO2-clint1a
Target: clint1a (1)
Previous Names: clint1-ex1 MO (1), MO2-clint1

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ACATCCAAAATACTCACGCTTTATC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-clint1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-clint1a
Expressed Gene Anatomy Figures
lcp1 Fig. 5 with image from Dodd et al., 2009
tp63 Fig. 5 with imageFig. 6 with image from Dodd et al., 2009
PHENOTYPE
Phenotype resulting from MO2-clint1a
Phenotype Figures
caudal fin epidermis hyperplastic, abnormal Fig. 6 from Walters et al., 2010
epidermis malformed, abnormal Fig. 5 with image from Dodd et al., 2009
epithelial cell proliferation increased rate, abnormal Fig. 5 with image from Dodd et al., 2009
neutrophil chemotaxis disrupted, abnormal Fig. 6 from Walters et al., 2010
ventral fin fold leukocyte mislocalised, abnormal Fig. 5 with image from Dodd et al., 2009

Phenotype of all Fish created by or utilizing MO2-clint1a
Phenotype Fish Conditions Figures
epithelial cell proliferation increased rate, abnormal AB + MO2-clint1a standard conditions Fig. 5 with image from Dodd et al., 2009
epidermis malformed, abnormal AB + MO2-clint1a standard conditions Fig. 5 with image from Dodd et al., 2009
ventral fin fold leukocyte mislocalised, abnormal AB + MO2-clint1a standard conditions Fig. 5 with image from Dodd et al., 2009
neutrophil chemotaxis disrupted, abnormal WT + MO2-clint1a standard conditions Fig. 6 from Walters et al., 2010
caudal fin epidermis hyperplastic, abnormal WT + MO2-clint1a standard conditions Fig. 6 from Walters et al., 2010
epidermis malformed, abnormal AB + MO1-llgl2 + MO2-clint1a standard conditions Fig. 6 with image from Dodd et al., 2009
ventral fin fold malformed, abnormal AB + MO1-llgl2 + MO2-clint1a standard conditions Fig. 6 with image from Dodd et al., 2009
OTHER MO2-clint1a MORPHOLINO PAGESNo links to external sites
CITATIONS (2)