Morpholino

MO2-mkxa

ID
ZDB-MRPHLNO-100506-5
Name
MO2-mkxa
Previous Names
  • Irxl1-MOII (1)
Target
Sequence
5' - CCAGTTAGACACCTGAAAATAAAAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-mkxa
Expressed Gene Anatomy Figures
egr2b Fig. 5 with image from Chuang et al., 2010
myod1 Fig. 6 with image from Chuang et al., 2010
runx2b Fig. 6 with image from Chuang et al., 2010
snai1b Fig. 7 with image from Chuang et al., 2010
sox9a Fig. 6 with image from Chuang et al., 2010
sox9b Fig. 7 with image from Chuang et al., 2010
wnt1 Fig. 5 with image from Chuang et al., 2010
Phenotype
Phenotype resulting from MO2-mkxa
Phenotype Fish Figures
brain malformed, abnormal WT + MO2-mkxa Fig. 5 with image from Chuang et al., 2010
brain morphogenesis process quality, abnormal WT + MO2-mkxa Fig. 5 with image from Chuang et al., 2010
ceratobranchial cartilage decreased amount, abnormal WT + MO2-mkxa Fig. 8 with image from Chuang et al., 2010
ceratobranchial cartilage malformed, abnormal WT + MO2-mkxa Fig. 8 with image from Chuang et al., 2010
ceratohyal cartilage malformed, abnormal WT + MO2-mkxa Fig. 8 with image from Chuang et al., 2010
embryonic viscerocranium morphogenesis process quality, abnormal WT + MO2-mkxa Fig. 6 with image,  Fig. 8 with image from Chuang et al., 2010
extraocular musculature decreased amount, abnormal WT + MO2-mkxa Fig. 6 with image from Chuang et al., 2010
eye decreased size, abnormal WT + MO2-mkxa Fig. 4 with image from Chuang et al., 2010
head decreased size, abnormal WT + MO2-mkxa Fig. 4 with image from Chuang et al., 2010
head flat, abnormal WT + MO2-mkxa Fig. 4 with image from Chuang et al., 2010
locomotion involved in locomotory behavior process quality, abnormal WT + MO2-mkxa Fig. 4 with image from Chuang et al., 2010
mandibular arch skeleton malformed, abnormal WT + MO2-mkxa Fig. 4 with image from Chuang et al., 2010
Meckel's cartilage decreased size, abnormal WT + MO2-mkxa Fig. 8 with image from Chuang et al., 2010
neural crest physical object quality, abnormal WT + MO2-mkxa Fig. 7 with image from Chuang et al., 2010
palatoquadrate cartilage decreased size, abnormal WT + MO2-mkxa Fig. 8 with image from Chuang et al., 2010
pharyngeal arch cartilage physical object quality, abnormal WT + MO2-mkxa Fig. 6 with image from Chuang et al., 2010
pharyngeal musculature decreased amount, abnormal WT + MO2-mkxa Fig. 6 with image from Chuang et al., 2010
post-vent region curved dorsal, abnormal WT + MO2-mkxa Fig. 4 with image from Chuang et al., 2010
ventricular system malformed, abnormal WT + MO2-mkxa Fig. 5 with image from Chuang et al., 2010
Phenotype of all Fish created by or utilizing MO2-mkxa
Phenotype Fish Conditions Figures
ceratohyal cartilage malformed, abnormal WT + MO2-mkxa standard conditions Fig. 8 with image from Chuang et al., 2010
eye decreased size, abnormal WT + MO2-mkxa standard conditions Fig. 4 with image from Chuang et al., 2010
palatoquadrate cartilage decreased size, abnormal WT + MO2-mkxa standard conditions Fig. 8 with image from Chuang et al., 2010
ventricular system malformed, abnormal WT + MO2-mkxa standard conditions Fig. 5 with image from Chuang et al., 2010
brain malformed, abnormal WT + MO2-mkxa standard conditions Fig. 5 with image from Chuang et al., 2010
pharyngeal musculature decreased amount, abnormal WT + MO2-mkxa standard conditions Fig. 6 with image from Chuang et al., 2010
extraocular musculature decreased amount, abnormal WT + MO2-mkxa standard conditions Fig. 6 with image from Chuang et al., 2010
head flat, abnormal WT + MO2-mkxa standard conditions Fig. 4 with image from Chuang et al., 2010
ceratobranchial cartilage decreased amount, abnormal WT + MO2-mkxa standard conditions Fig. 8 with image from Chuang et al., 2010
neural crest physical object quality, abnormal WT + MO2-mkxa standard conditions Fig. 7 with image from Chuang et al., 2010
ceratobranchial cartilage malformed, abnormal WT + MO2-mkxa standard conditions Fig. 8 with image from Chuang et al., 2010
locomotion involved in locomotory behavior process quality, abnormal WT + MO2-mkxa standard conditions Fig. 4 with image from Chuang et al., 2010
mandibular arch skeleton malformed, abnormal WT + MO2-mkxa standard conditions Fig. 4 with image from Chuang et al., 2010
embryonic viscerocranium morphogenesis process quality, abnormal WT + MO2-mkxa standard conditions Fig. 6 with image,  Fig. 8 with image from Chuang et al., 2010
head decreased size, abnormal WT + MO2-mkxa standard conditions Fig. 4 with image from Chuang et al., 2010
pharyngeal arch cartilage physical object quality, abnormal WT + MO2-mkxa standard conditions Fig. 6 with image from Chuang et al., 2010
post-vent region curved dorsal, abnormal WT + MO2-mkxa standard conditions Fig. 4 with image from Chuang et al., 2010
brain morphogenesis process quality, abnormal WT + MO2-mkxa standard conditions Fig. 5 with image from Chuang et al., 2010
Meckel's cartilage decreased size, abnormal WT + MO2-mkxa standard conditions Fig. 8 with image from Chuang et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.