header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100504-6
Morpholino Name: MO3-arl6
Target: arl6 (1)
Previous Name: bbs3_long (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ATTTCAGCTTCAGTACTTACAGTGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-arl6 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-arl6
Expressed Gene Anatomy Figures
opn1mw1 Fig. 4 with image from Pretorius et al., 2010
PHENOTYPE
Phenotype resulting from MO3-arl6
Phenotype of all Fish created by or utilizing MO3-arl6
OTHER MO3-arl6 MORPHOLINO PAGES No links to external sites
CITATIONS (1)