header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100504-4
Morpholino Name: MO3-mmp9
Target: mmp9 (1)
Sequence:
5' - GTAAGTTTACCTCTGTTAGGGCAGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: exon 6-7 boundary
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-mmp9 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-mmp9 No data available
PHENOTYPE
Phenotype resulting from MO3-mmp9
No data available

Phenotype of all Fish created by or utilizing MO3-mmp9
No data available
OTHER MO3-mmp9 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)