header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100503-1
Morpholino Name: MO2-vsx2
Target: vsx2 (1)
Previous Names: PZF1245-8858272, vsx2aATGMO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CCTTTCCTGTCATGGTGCCTCTGAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-vsx2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-vsx2
Expressed Gene Anatomy Figures
atoh7 Fig. 12 with image from Vitorino et al., 2009
bhlhe23 Fig. 12 with image from Vitorino et al., 2009
crx Fig. 12 with image from Vitorino et al., 2009
eef1a1l1 Fig. 12 with image from Vitorino et al., 2009
foxn4 Fig. 12 with image from Vitorino et al., 2009
hem Fig. 13 with image from Vitorino et al., 2009
isl1 Fig. 13 with image from Vitorino et al., 2009
mitfa Fig. 12 with image from Vitorino et al., 2009
rbpms2b Fig. 13 with image from Vitorino et al., 2009
rx3 Fig. 12 with image from Vitorino et al., 2009
sox2 Fig. 13 with image from Vitorino et al., 2009
vsx1 Fig. 12 with image from Vitorino et al., 2009
vsx2 Fig. 12 with image from Vitorino et al., 2009
PHENOTYPE
Phenotype resulting from MO2-vsx2
Phenotype of all Fish created by or utilizing MO2-vsx2
OTHER MO2-vsx2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)