Morpholino

MO3-fkrp

ID
ZDB-MRPHLNO-100426-7
Name
MO3-fkrp
Previous Names
  • FKRP MO 2 (1)
Target
Sequence
5' - CTTGTGGTTTTATGGCAGAAAGAGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-fkrp
Expressed Gene Anatomy Figures
dag1 Fig. 3,  Fig. 6 from Kawahara et al., 2010
dmd Fig. 3 from Kawahara et al., 2010
fkrp Fig. 2 from Kawahara et al., 2010
Phenotype
Phenotype resulting from MO3-fkrp
Phenotype Fish Figures
endoplasmic reticulum unfolded protein response increased occurrence, abnormal AB + MO3-fkrp Fig. 2 with image from Bailey et al., 2019
eye decreased size, abnormal AB + MO3-fkrp Fig. 1,  Fig. S1 from Kawahara et al., 2010
eye morphogenesis disrupted, abnormal AB + MO3-fkrp Fig. S1 from Kawahara et al., 2010
head morphology, abnormal AB + MO3-fkrp Fig. S1 from Kawahara et al., 2010
head morphogenesis disrupted, abnormal AB + MO3-fkrp Fig. S1 from Kawahara et al., 2010
intersegmental vessel decreased length, abnormal y1Tg + MO3-fkrp Fig. 2 with image from Bailey et al., 2019
muscle disorganized, abnormal AB + MO3-fkrp Fig. S1 from Kawahara et al., 2010
muscle structure, abnormal AB + MO3-fkrp Fig. 1 with image,  Fig. 3 with image,  Fig. 4 with image,  Fig. 8 with image from Bailey et al., 2019
muscle cell irregular spatial pattern, abnormal AB + MO3-fkrp Fig. 1,  Fig. 2 from Kawahara et al., 2010
myoseptum disorganized, abnormal AB + MO3-fkrp Fig. 2 from Kawahara et al., 2010
myoseptum increased distance myoseptum, abnormal AB + MO3-fkrp Fig. 7 from Kawahara et al., 2010
myotome degenerate, abnormal AB + MO3-fkrp Fig. 1 with image,  Fig. 3 with image,  Fig. 4 with image,  Fig. 8 with image from Bailey et al., 2019
myotome myofibril decreased length, abnormal AB + MO3-fkrp Fig. 3 from Kawahara et al., 2010
myotome myofibril refractivity, abnormal AB + MO3-fkrp Fig. 1,  Fig. 2,  Fig. 5,  Fig. 6 from Kawahara et al., 2010
myotome myofibril spatial pattern, abnormal AB + MO3-fkrp Fig. 3,  Fig. 7 from Kawahara et al., 2010
pericardium increased size, abnormal AB + MO3-fkrp Fig. 1 from Kawahara et al., 2010
post-vent region curved ventral, abnormal AB + MO3-fkrp Fig. S1 from Kawahara et al., 2010
sensory perception of touch disrupted, abnormal AB + MO3-fkrp Fig. 1 from Kawahara et al., 2010
skeletal muscle neuromuscular junction morphology, abnormal AB + MO3-fkrp Fig. 5 with image,  Fig. 7 with image from Bailey et al., 2019
thigmotaxis decreased occurrence, abnormal AB + MO3-fkrp Fig. 1 with image,  Fig. 3 with image,  Fig. 4 with image,  Fig. 8 with image from Bailey et al., 2019
vertical myoseptum curved, abnormal AB + MO3-fkrp Fig. 3,  Fig. S1 from Kawahara et al., 2010
voluntary musculoskeletal movement disrupted, abnormal AB + MO3-fkrp Fig. 1 from Kawahara et al., 2010
whole organism immobile, abnormal AB + MO3-fkrp Fig. 1 from Kawahara et al., 2010
whole organism laminin binding decreased occurrence, abnormal AB + MO3-fkrp Fig. 6 from Kawahara et al., 2010
Phenotype of all Fish created by or utilizing MO3-fkrp
Phenotype Fish Conditions Figures
eye decreased size, abnormal AB + MO3-fkrp standard conditions Fig. 1,  Fig. S1 from Kawahara et al., 2010
voluntary musculoskeletal movement disrupted, abnormal AB + MO3-fkrp standard conditions Fig. 1 from Kawahara et al., 2010
myotome degenerate, abnormal AB + MO3-fkrp chemical treatment by environment: NAD Fig. 4 with image from Bailey et al., 2019
thigmotaxis decreased occurrence, abnormal AB + MO3-fkrp chemical treatment by environment: NAD Fig. 4 with image from Bailey et al., 2019
myoseptum disorganized, abnormal AB + MO3-fkrp standard conditions Fig. 2 from Kawahara et al., 2010
myotome myofibril refractivity, abnormal AB + MO3-fkrp standard conditions Fig. 1,  Fig. 2,  Fig. 5,  Fig. 6 from Kawahara et al., 2010
skeletal muscle neuromuscular junction morphology, ameliorated AB + MO3-fkrp chemical treatment by environment: nicotinamide Fig. 5 with image,  Fig. 7 with image from Bailey et al., 2019
sensory perception of touch disrupted, abnormal AB + MO3-fkrp standard conditions Fig. 1 from Kawahara et al., 2010
thigmotaxis decreased occurrence, ameliorated AB + MO3-fkrp chemical treatment by environment: NAD Fig. 1 with image from Bailey et al., 2019
whole organism laminin binding decreased occurrence, abnormal AB + MO3-fkrp standard conditions Fig. 6 from Kawahara et al., 2010
thigmotaxis decreased occurrence, ameliorated AB + MO3-fkrp chemical treatment by environment: nicotinamide Fig. 1 with image from Bailey et al., 2019
muscle disorganized, abnormal AB + MO3-fkrp standard conditions Fig. S1 from Kawahara et al., 2010
skeletal muscle neuromuscular junction morphology, exacerbated AB + MO3-fkrp chemical treatment by environment: NAD Fig. 7 with image from Bailey et al., 2019
muscle cell irregular spatial pattern, abnormal AB + MO3-fkrp standard conditions Fig. 1,  Fig. 2 from Kawahara et al., 2010
vertical myoseptum curved, abnormal AB + MO3-fkrp standard conditions Fig. 3,  Fig. S1 from Kawahara et al., 2010
muscle structure, abnormal AB + MO3-fkrp chemical treatment by environment: NAD Fig. 4 with image from Bailey et al., 2019
head morphology, abnormal AB + MO3-fkrp standard conditions Fig. S1 from Kawahara et al., 2010
head morphogenesis disrupted, abnormal AB + MO3-fkrp standard conditions Fig. S1 from Kawahara et al., 2010
thigmotaxis decreased occurrence, abnormal AB + MO3-fkrp chemical treatment by environment: nicotinamide Fig. 4 with image from Bailey et al., 2019
eye morphogenesis disrupted, abnormal AB + MO3-fkrp standard conditions Fig. S1 from Kawahara et al., 2010
endoplasmic reticulum unfolded protein response increased occurrence, abnormal AB + MO3-fkrp chemical treatment by environment: nicotinamide Fig. 2 with image from Bailey et al., 2019
myotome myofibril decreased length, abnormal AB + MO3-fkrp standard conditions Fig. 3 from Kawahara et al., 2010
myotome myofibril spatial pattern, abnormal AB + MO3-fkrp standard conditions Fig. 3,  Fig. 7 from Kawahara et al., 2010
myotome degenerate, ameliorated AB + MO3-fkrp chemical treatment by environment: NAD Fig. 1 with image from Bailey et al., 2019
myotome degenerate, abnormal AB + MO3-fkrp chemical treatment by environment: nicotinamide Fig. 4 with image from Bailey et al., 2019
skeletal muscle neuromuscular junction morphology, ameliorated AB + MO3-fkrp chemical treatment by environment: NAD Fig. 5 with image from Bailey et al., 2019
myoseptum increased distance myoseptum, abnormal AB + MO3-fkrp standard conditions Fig. 7 from Kawahara et al., 2010
muscle structure, abnormal AB + MO3-fkrp standard conditions Fig. 1 with image,  Fig. 3 with image,  Fig. 4 with image,  Fig. 8 with image from Bailey et al., 2019
muscle structure, ameliorated AB + MO3-fkrp chemical treatment by environment: NAD Fig. 1 with image from Bailey et al., 2019
post-vent region curved ventral, abnormal AB + MO3-fkrp standard conditions Fig. S1 from Kawahara et al., 2010
skeletal muscle neuromuscular junction morphology, abnormal AB + MO3-fkrp standard conditions Fig. 5 with image,  Fig. 7 with image from Bailey et al., 2019
thigmotaxis decreased occurrence, abnormal AB + MO3-fkrp standard conditions Fig. 1 with image,  Fig. 3 with image,  Fig. 4 with image,  Fig. 8 with image from Bailey et al., 2019
myotome degenerate, abnormal AB + MO3-fkrp standard conditions Fig. 1 with image,  Fig. 3 with image,  Fig. 4 with image,  Fig. 8 with image from Bailey et al., 2019
pericardium increased size, abnormal AB + MO3-fkrp standard conditions Fig. 1 from Kawahara et al., 2010
endoplasmic reticulum unfolded protein response increased occurrence, abnormal AB + MO3-fkrp standard conditions Fig. 2 with image from Bailey et al., 2019
whole organism immobile, abnormal AB + MO3-fkrp standard conditions Fig. 1 from Kawahara et al., 2010
intersegmental vessel decreased length, abnormal y1Tg + MO3-fkrp standard conditions Fig. 2 with image from Bailey et al., 2019
intersegmental vessel decreased length, abnormal y1Tg + MO3-fkrp chemical treatment by environment: NAD Fig. 2 with image from Bailey et al., 2019
myotome degenerate, abnormal mai3Tg + MO3-fkrp standard conditions Fig. 3 with image from Bailey et al., 2019
muscle structure, ameliorated mai3Tg + MO3-fkrp standard conditions Fig. 3 with image from Bailey et al., 2019
thigmotaxis decreased occurrence, abnormal mai3Tg + MO3-fkrp standard conditions Fig. 3 with image from Bailey et al., 2019
myotome degenerate, ameliorated zf3207Tg + MO3-fkrp standard conditions Fig. 8 with image from Bailey et al., 2019
muscle structure, ameliorated zf3207Tg + MO3-fkrp standard conditions Fig. 8 with image from Bailey et al., 2019
muscle structure, ameliorated zf3208Tg + MO3-fkrp standard conditions Fig. 8 with image from Bailey et al., 2019
thigmotaxis decreased occurrence, abnormal zf3208Tg + MO3-fkrp standard conditions Fig. 8 with image from Bailey et al., 2019
myotome degenerate, abnormal zf3208Tg + MO3-fkrp standard conditions Fig. 8 with image from Bailey et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.