Morpholino

MO2-fkrp

ID
ZDB-MRPHLNO-100426-4
Name
MO2-fkrp
Previous Names
  • FKRP MO 1 (1)
Target
Sequence
5' - TGGCAAAAACTGATACGCATTATGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-fkrp
Expressed Gene Anatomy Figures
fkrp Fig. 2 from Kawahara et al., 2010
Phenotype
Phenotype resulting from MO2-fkrp
Phenotype Fish Figures
eye decreased size, abnormal AB + MO2-fkrp Fig. 1 from Kawahara et al., 2010
eye morphology, abnormal AB + MO2-fkrp Fig. S1 from Kawahara et al., 2010
eye morphogenesis disrupted, abnormal AB + MO2-fkrp Fig. S1 from Kawahara et al., 2010
head morphology, abnormal AB + MO2-fkrp Fig. S1 from Kawahara et al., 2010
head morphogenesis disrupted, abnormal AB + MO2-fkrp Fig. S1 from Kawahara et al., 2010
muscle disorganized, abnormal AB + MO2-fkrp Fig. S1 from Kawahara et al., 2010
muscle cell irregular spatial pattern, abnormal AB + MO2-fkrp Fig. 1,  Fig. 2 from Kawahara et al., 2010
myoseptum disorganized, abnormal AB + MO2-fkrp Fig. 2 from Kawahara et al., 2010
myotome myofibril refractivity, abnormal AB + MO2-fkrp Fig. 1,  Fig. 2 from Kawahara et al., 2010
pericardium increased size, abnormal AB + MO2-fkrp Fig. 1 from Kawahara et al., 2010
post-vent region curved ventral, abnormal AB + MO2-fkrp Fig. S1 from Kawahara et al., 2010
sensory perception of touch disrupted, abnormal AB + MO2-fkrp Fig. 1 from Kawahara et al., 2010
vertical myoseptum curved, abnormal AB + MO2-fkrp Fig. S1 from Kawahara et al., 2010
voluntary musculoskeletal movement disrupted, abnormal AB + MO2-fkrp Fig. 1 from Kawahara et al., 2010
whole organism immobile, abnormal AB + MO2-fkrp Fig. 1 from Kawahara et al., 2010
Phenotype of all Fish created by or utilizing MO2-fkrp
Phenotype Fish Conditions Figures
head morphology, abnormal AB + MO2-fkrp standard conditions Fig. S1 from Kawahara et al., 2010
muscle cell irregular spatial pattern, abnormal AB + MO2-fkrp standard conditions Fig. 1,  Fig. 2 from Kawahara et al., 2010
muscle disorganized, abnormal AB + MO2-fkrp standard conditions Fig. S1 from Kawahara et al., 2010
vertical myoseptum curved, abnormal AB + MO2-fkrp standard conditions Fig. S1 from Kawahara et al., 2010
eye morphology, abnormal AB + MO2-fkrp standard conditions Fig. S1 from Kawahara et al., 2010
myotome myofibril refractivity, abnormal AB + MO2-fkrp standard conditions Fig. 1,  Fig. 2 from Kawahara et al., 2010
pericardium increased size, abnormal AB + MO2-fkrp standard conditions Fig. 1 from Kawahara et al., 2010
myoseptum disorganized, abnormal AB + MO2-fkrp standard conditions Fig. 2 from Kawahara et al., 2010
eye morphogenesis disrupted, abnormal AB + MO2-fkrp standard conditions Fig. S1 from Kawahara et al., 2010
voluntary musculoskeletal movement disrupted, abnormal AB + MO2-fkrp standard conditions Fig. 1 from Kawahara et al., 2010
eye decreased size, abnormal AB + MO2-fkrp standard conditions Fig. 1 from Kawahara et al., 2010
whole organism immobile, abnormal AB + MO2-fkrp standard conditions Fig. 1 from Kawahara et al., 2010
sensory perception of touch disrupted, abnormal AB + MO2-fkrp standard conditions Fig. 1 from Kawahara et al., 2010
post-vent region curved ventral, abnormal AB + MO2-fkrp standard conditions Fig. S1 from Kawahara et al., 2010
head morphogenesis disrupted, abnormal AB + MO2-fkrp standard conditions Fig. S1 from Kawahara et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.