header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100423-8
Morpholino Name: MO3-arnt2
Target: arnt2 (1)
Previous Name: arnt2 (e2i2) (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTCTCAGAAGAATTGCTCACCCCGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: splice-blocker
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-arnt2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-arnt2
Expressed Gene Anatomy Figures
th Fig. 3 with image from Löhr et al., 2009
PHENOTYPE
Phenotype resulting from MO3-arnt2
Phenotype of all Fish created by or utilizing MO3-arnt2
OTHER MO3-arnt2 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)