ZFIN ID: ZDB-MRPHLNO-100423-2
Morpholino Name: MO3-rx1
Target: rx1 (1)
Previous Name: rx1 ATG-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCATGGTGTCCAGTGACAAATGCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-rx1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-rx1 No data available
PHENOTYPE
Phenotype resulting from MO3-rx1
No data available

Phenotype of all Fish created by or utilizing MO3-rx1
Phenotype Fish Conditions Figures
retinal outer nuclear layer decreased thickness, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 1 with image from Nelson et al., 2009
retina apoptotic, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 6 with image from Nelson et al., 2009
retina lacks all parts of type Muller cell, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 1 with image from Nelson et al., 2009
retina layer formation delayed, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 1 with image from Nelson et al., 2009
neural retina development disrupted, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 5 with image from Nelson et al., 2009
neural retina development delayed, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 4 with image from Nelson et al., 2009
retinal cone cell differentiation disrupted, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 1 with imageFig. 2 with image from Nelson et al., 2009
cell population proliferation disrupted, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 5 with image from Nelson et al., 2009
retinal rod cell differentiation disrupted, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 1 with image from Nelson et al., 2009
cell death increased occurrence, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 6 with image from Nelson et al., 2009
retina layer formation disrupted, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 1 with imageFig. 2 with image from Nelson et al., 2009
retina decreased size, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 1 with image from Nelson et al., 2009
retinal bipolar neuron differentiation disrupted, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 1 with image from Nelson et al., 2009
eye photoreceptor cell differentiation disrupted, abnormal WT + MO2-rx1 + MO2-rx2 + MO3-rx1 + MO3-rx2 standard conditions Fig. 11 with image from Nelson et al., 2009
OTHER MO3-rx1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)