header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100423-10
Morpholino Name: MO2-sim1a
Target: sim1a (1)
Previous Name: sim1a (e2i2) (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGTGATTGTGTACCTGAAGCAGATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: splice-blocker
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-sim1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-sim1a
Expressed Gene Anatomy Figures
avp Fig. 4 with image from Löhr et al., 2009
crhb Fig. 4 with image from Löhr et al., 2009
oxt Fig. 4 with image from Löhr et al., 2009
robo3 Fig. 4 with image from Schweitzer et al., 2013
slc12a1 Fig. 3 with image from Cheng et al., 2015
slc12a3 Fig. 3 with image from Cheng et al., 2015
slc20a1a Fig. 3 with image from Cheng et al., 2015
sst1.1 Fig. 4 with image from Löhr et al., 2009
stc1 Fig. 3 with image from Cheng et al., 2015
th Fig. 3 with image from Löhr et al., 2009
trh Fig. 4 with image from Löhr et al., 2009
trpm7 Fig. 3 with image from Cheng et al., 2015
uts1 Fig. 7 with image from Wolf et al., 2013
vip Fig. 7 with image from Wolf et al., 2013
PHENOTYPE
Phenotype resulting from MO2-sim1a
Phenotype Figures
caudal tuberculum dopaminergic neuron decreased amount, abnormal Fig. 3 with image from Löhr et al., 2009
caudal tuberculum neurosecretory neuron decreased amount, abnormal Fig. 4 with image from Löhr et al., 2009
corpuscles of Stannius stc1 expression absent, abnormal Fig. 3 with image from Cheng et al., 2015
diencephalic nucleus axon displaced to hindbrain medial region, abnormal Fig. 1 with imageFig. 7 with image from Schweitzer et al., 2013
diencephalon neurosecretory neuron mislocalised, abnormal Fig. 4 with image from Löhr et al., 2009
dopaminergic neuron axon displaced to hindbrain medial region, abnormal Fig. 2 with image from Schweitzer et al., 2013
dopaminergic neuron differentiation process quality, abnormal Fig. 3 with image from Löhr et al., 2009
hypothalamus dopaminergic neuron decreased amount, abnormal Fig. 3 with image from Löhr et al., 2009
hypothalamus neurosecretory neuron decreased amount, abnormal Fig. 4 with image from Löhr et al., 2009
hypothalamus cell differentiation process quality, abnormal Fig. 4 with image from Löhr et al., 2009
preoptic area neurosecretory neuron decreased amount, abnormal Fig. 4 with image from Löhr et al., 2009
pronephric proximal convoluted tubule distended, abnormal Fig. 3 with image from Cheng et al., 2015
pronephric proximal convoluted tubule slc20a1a expression increased distribution, abnormal Fig. 3 with image from Cheng et al., 2015
pronephric proximal convoluted tubule slc20a1a expression mislocalised, abnormal Fig. 3 with image from Cheng et al., 2015
pronephric proximal convoluted tubule mislocalised posteriorly, abnormal Fig. 3 with image from Cheng et al., 2015
pronephric proximal straight tubule trpm7 expression absent, abnormal Fig. 3 with image from Cheng et al., 2015
pronephric proximal straight tubule decreased size, abnormal Fig. 3 with image from Cheng et al., 2015
pronephric proximal tubule morphogenesis decreased process quality, abnormal Fig. 3 with image from Cheng et al., 2015
pronephric proximal tubule morphogenesis process quality, abnormal Fig. 3 with image from Cheng et al., 2015
pronephros lacks all parts of type corpuscles of Stannius, abnormal Fig. 3 with image from Cheng et al., 2015

Phenotype of all Fish created by or utilizing MO2-sim1a
Phenotype Fish Conditions Figures
pronephric proximal convoluted tubule slc20a1a expression mislocalised, abnormal TU + MO2-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephric proximal convoluted tubule slc20a1a expression increased distribution, abnormal TU + MO2-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephros lacks all parts of type corpuscles of Stannius, abnormal TU + MO2-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephric proximal straight tubule decreased size, abnormal TU + MO2-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephric proximal convoluted tubule distended, abnormal TU + MO2-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
corpuscles of Stannius stc1 expression absent, abnormal TU + MO2-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephric proximal tubule morphogenesis decreased process quality, abnormal TU + MO2-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephric proximal convoluted tubule mislocalised posteriorly, abnormal TU + MO2-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephric proximal tubule morphogenesis process quality, abnormal TU + MO2-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephric proximal straight tubule trpm7 expression absent, abnormal TU + MO2-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
hypothalamus neurosecretory neuron decreased amount, abnormal WT + MO2-sim1a standard conditions Fig. 4 with image from Löhr et al., 2009
dopaminergic neuron differentiation process quality, abnormal WT + MO2-sim1a standard conditions Fig. 3 with image from Löhr et al., 2009
caudal tuberculum neurosecretory neuron decreased amount, abnormal WT + MO2-sim1a standard conditions Fig. 4 with image from Löhr et al., 2009
hypothalamus dopaminergic neuron decreased amount, abnormal WT + MO2-sim1a standard conditions Fig. 3 with image from Löhr et al., 2009
preoptic area neurosecretory neuron decreased amount, abnormal WT + MO2-sim1a standard conditions Fig. 4 with image from Löhr et al., 2009
dopaminergic neuron axon displaced to hindbrain medial region, abnormal WT + MO2-sim1a standard conditions Fig. 2 with image from Schweitzer et al., 2013
diencephalon neurosecretory neuron mislocalised, abnormal WT + MO2-sim1a standard conditions Fig. 4 with image from Löhr et al., 2009
hypothalamus cell differentiation process quality, abnormal WT + MO2-sim1a standard conditions Fig. 4 with image from Löhr et al., 2009
caudal tuberculum dopaminergic neuron decreased amount, abnormal WT + MO2-sim1a standard conditions Fig. 3 with image from Löhr et al., 2009
diencephalic nucleus axon displaced to hindbrain medial region, abnormal zc49Tg + MO2-sim1a standard conditions Fig. 1 with imageFig. 7 with image from Schweitzer et al., 2013
diencephalic nucleus axon displaced to hindbrain medial region, abnormal zc49Tg + MO2-sim1a + MO3-arnt2 standard conditions Fig. 1 with image from Schweitzer et al., 2013
diencephalic nucleus axon displaced to hindbrain medial region, abnormal robo2ti272z/ti272z; robo3tw204/+; zc49Tg + MO2-sim1a standard conditions Fig. 8 with image from Schweitzer et al., 2013
diencephalic nucleus axon displaced to hindbrain medial region, abnormal robo2ti272z/ti272z; robo3tw204/tw204; zc49Tg + MO2-sim1a standard conditions Fig. 8 with image from Schweitzer et al., 2013
OTHER MO2-sim1a MORPHOLINO PAGESNo links to external sites
CITATIONS (5)