Morpholino

MO1-ids

ID
ZDB-MRPHLNO-100422-6
Name
MO1-ids
Previous Names
  • ids ATG MO (1)
Target
Sequence
5' - GTAAATACGAGCATTACATTCATTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ids
Phenotype
Phenotype resulting from MO1-ids
Phenotype Fish Figures
atrioventricular canal GFP expression increased amount, abnormal ia4Tg + MO1-ids Fig. 6 from Costa et al., 2017
atrioventricular valve disorganized, abnormal ia5Tg + MO1-ids Fig. 6 from Costa et al., 2017
atrium increased size, abnormal ia18Tg + MO1-ids Fig. 4 from Costa et al., 2017
basihyal cartilage deformed, abnormal WT + MO1-ids Fig. 5 from Moro et al., 2010
bulbus arteriosus GFP expression increased amount, abnormal ia4Tg + MO1-ids Fig. 6 from Costa et al., 2017
ceratohyal cartilage deformed, abnormal WT + MO1-ids Fig. 5 from Moro et al., 2010
diencephalon dorsal region spry4 expression increased amount, abnormal WT + MO1-ids Fig. 1 from Bellesso et al., 2018
diencephalon ventral region fgf8a expression increased amount, abnormal WT + MO1-ids Fig. 1 from Bellesso et al., 2018
embryo development disrupted, abnormal WT + MO1-ids Fig. 4 from Moro et al., 2010
forebrain ventricular zone fgfr3 expression increased amount, abnormal WT + MO1-ids Fig. 1 from Bellesso et al., 2018
head deformed, abnormal WT + MO1-ids Fig. 4 from Moro et al., 2010
heart tube GFP expression decreased amount, abnormal ia11Tg + MO1-ids Fig. 1 from Costa et al., 2017
Meckel's cartilage deformed, abnormal WT + MO1-ids Fig. 5 from Moro et al., 2010
midbrain hindbrain boundary spry4 expression increased amount, abnormal WT + MO1-ids Fig. 1 from Bellesso et al., 2018
neuromast etv4 expression increased amount, abnormal WT + MO1-ids Fig. 1 from Bellesso et al., 2018
notochord tbxta expression increased amount, abnormal WT + MO1-ids Fig. 1 from Bellesso et al., 2018
pectoral fin etv4 expression increased amount, abnormal WT + MO1-ids Fig. 1 from Bellesso et al., 2018
pharyngeal arch 3-7 deformed, abnormal WT + MO1-ids Fig. 5 from Moro et al., 2010
pharyngeal endoderm fgf3 expression increased amount, abnormal WT + MO1-ids Fig. 1 from Bellesso et al., 2018
post-vent region neural tube GFP expression decreased amount, abnormal ia11Tg + MO1-ids Fig. 1 from Costa et al., 2017
regulation of canonical Wnt signaling pathway involved in heart development disrupted, abnormal ia4Tg + MO1-ids Fig. 6 from Costa et al., 2017
smoothened signaling pathway decreased process quality, abnormal ia11Tg + MO1-ids Fig. 1 from Costa et al., 2017
telencephalon fgf8a expression increased amount, abnormal WT + MO1-ids Fig. 1 from Bellesso et al., 2018
trunk decreased size, abnormal WT + MO1-ids Fig. 4 from Moro et al., 2010
trunk neural tube GFP expression decreased amount, abnormal ia11Tg + MO1-ids Fig. 1 from Costa et al., 2017
whole organism mCherry expression decreased amount, abnormal ia11Tg ; ia10Tg + MO1-ids Fig. 1 from Costa et al., 2017
whole organism d2EGFP expression increased amount, abnormal pt6Tg + MO1-ids Fig. 1 from Bellesso et al., 2018
whole organism etv5b expression increased amount, abnormal pt6Tg + MO1-ids Fig. 1 from Bellesso et al., 2018
whole organism mapk3 expression increased amount, abnormal pt6Tg + MO1-ids Fig. 1 from Bellesso et al., 2018
whole organism etv4 expression increased amount, abnormal pt6Tg + MO1-ids Fig. 1 from Bellesso et al., 2018
yolk vasculature decreased amount, abnormal WT + MO1-ids Fig. 4 from Moro et al., 2010
Phenotype of all Fish created by or utilizing MO1-ids
Phenotype Fish Conditions Figures
neuromast etv4 expression increased amount, abnormal WT + MO1-ids standard conditions Fig. 1 from Bellesso et al., 2018
basihyal cartilage deformed, abnormal WT + MO1-ids standard conditions Fig. 5 from Moro et al., 2010
yolk vasculature decreased amount, abnormal WT + MO1-ids standard conditions Fig. 4 from Moro et al., 2010
forebrain ventricular zone fgfr3 expression increased amount, abnormal WT + MO1-ids standard conditions Fig. 1 from Bellesso et al., 2018
diencephalon dorsal region spry4 expression increased amount, abnormal WT + MO1-ids standard conditions Fig. 1 from Bellesso et al., 2018
telencephalon fgf8a expression increased amount, abnormal WT + MO1-ids standard conditions Fig. 1 from Bellesso et al., 2018
pharyngeal arch 3-7 deformed, abnormal WT + MO1-ids standard conditions Fig. 5 from Moro et al., 2010
trunk decreased size, abnormal WT + MO1-ids standard conditions Fig. 4 from Moro et al., 2010
pectoral fin etv4 expression increased amount, abnormal WT + MO1-ids standard conditions Fig. 1 from Bellesso et al., 2018
embryo development disrupted, abnormal WT + MO1-ids standard conditions Fig. 4 from Moro et al., 2010
notochord tbxta expression increased amount, abnormal WT + MO1-ids standard conditions Fig. 1 from Bellesso et al., 2018
diencephalon ventral region fgf8a expression increased amount, abnormal WT + MO1-ids standard conditions Fig. 1 from Bellesso et al., 2018
ceratohyal cartilage deformed, abnormal WT + MO1-ids standard conditions Fig. 5 from Moro et al., 2010
head deformed, abnormal WT + MO1-ids standard conditions Fig. 4 from Moro et al., 2010
midbrain hindbrain boundary spry4 expression increased amount, abnormal WT + MO1-ids standard conditions Fig. 1 from Bellesso et al., 2018
pharyngeal endoderm fgf3 expression increased amount, abnormal WT + MO1-ids standard conditions Fig. 1 from Bellesso et al., 2018
Meckel's cartilage deformed, abnormal WT + MO1-ids standard conditions Fig. 5 from Moro et al., 2010
heart rudiment smoothened signaling pathway disrupted, abnormal el108Tg + MO1-ids standard conditions Fig. 5 from Costa et al., 2017
smoothened signaling pathway decreased process quality, abnormal el108Tg + MO1-ids standard conditions Fig. 5 from Costa et al., 2017
atrium increased size, abnormal el108Tg + MO1-ids standard conditions Fig. 4 from Costa et al., 2017
myocardium increased thickness, abnormal el108Tg + MO1-ids standard conditions Fig. 4 from Costa et al., 2017
cardiac ventricle heart trabecula formation disrupted, ameliorated el108Tg + MO1-ids chemical treatment by environment: purmorphamine Fig. 5 from Costa et al., 2017
trabecular layer of ventricle decreased size, ameliorated el108Tg + MO1-ids chemical treatment by environment: purmorphamine Fig. 5 from Costa et al., 2017
trabecular layer of ventricle decreased size, abnormal el108Tg + MO1-ids standard conditions Fig. 5 from Costa et al., 2017
cardiac ventricle heart trabecula formation disrupted, abnormal el108Tg + MO1-ids standard conditions Fig. 4Fig. 5 from Costa et al., 2017
trabecular layer of the atrium absent, abnormal el108Tg + MO1-ids standard conditions Fig. 4 from Costa et al., 2017
atrioventricular canal GFP expression increased amount, abnormal ia4Tg + MO1-ids standard conditions Fig. 6 from Costa et al., 2017
regulation of canonical Wnt signaling pathway involved in heart development disrupted, abnormal ia4Tg + MO1-ids standard conditions Fig. 6 from Costa et al., 2017
bulbus arteriosus GFP expression increased amount, abnormal ia4Tg + MO1-ids standard conditions Fig. 6 from Costa et al., 2017
atrioventricular valve disorganized, abnormal ia5Tg + MO1-ids standard conditions Fig. 6 from Costa et al., 2017
smoothened signaling pathway decreased process quality, abnormal ia11Tg + MO1-ids standard conditions Fig. 1 from Costa et al., 2017
post-vent region neural tube GFP expression decreased amount, abnormal ia11Tg + MO1-ids standard conditions Fig. 1 from Costa et al., 2017
trunk neural tube GFP expression decreased amount, abnormal ia11Tg + MO1-ids standard conditions Fig. 1 from Costa et al., 2017
heart tube GFP expression decreased amount, abnormal ia11Tg + MO1-ids standard conditions Fig. 1 from Costa et al., 2017
atrium increased size, abnormal ia18Tg + MO1-ids standard conditions Fig. 4 from Costa et al., 2017
whole organism etv5b expression increased amount, abnormal pt6Tg + MO1-ids standard conditions Fig. 1 from Bellesso et al., 2018
whole organism etv4 expression increased amount, abnormal pt6Tg + MO1-ids standard conditions Fig. 1 from Bellesso et al., 2018
whole organism mapk3 expression increased amount, abnormal pt6Tg + MO1-ids standard conditions Fig. 1 from Bellesso et al., 2018
whole organism d2EGFP expression increased amount, abnormal pt6Tg + MO1-ids standard conditions Fig. 1 from Bellesso et al., 2018
whole organism mCherry expression decreased amount, abnormal ia11Tg ; ia10Tg + MO1-ids standard conditions Fig. 1 from Costa et al., 2017
Citations