header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100416-9
Morpholino Name: MO1-adrb1
Target: adrb1 (1)
Sequence:
5' - GGTAGCCCGTCTCCCATGATTTGGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-adrb1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-adrb1 No data available
PHENOTYPE
Phenotype resulting from MO1-adrb1
Phenotype of all Fish created by or utilizing MO1-adrb1
OTHER MO1-adrb1 MORPHOLINO PAGES No links to external sites
CITATIONS (1)