ZFIN ID: ZDB-MRPHLNO-100416-1
Morpholino Name: MO5-tbx16
Target: tbx16 (1)
Previous Name: sptc-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CTGGTGTATCTAAGTGTTTCAGTTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets the 5'UTR
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-tbx16 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-tbx16 No data available
PHENOTYPE
Phenotype resulting from MO5-tbx16
No data available

Phenotype of all Fish created by or utilizing MO5-tbx16
No data available
OTHER MO5-tbx16 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)