Morpholino

MO1-ifng1

ID

ZDB-MRPHLNO-100415-13

Name

MO1-ifng1

Previous Names

MO1-ifng1-2
ifngamma1-2-MO1 (1)

Target

ifng1 (1)

Sequence

5' - TGAAGGCGTTCGCTAAAGTTAGAGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Targets the 5' UTR of ifng1-2.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ifng1

Expressed Gene	Anatomy	Figures
ifngr1	axial vasculature	Fig. 5 from Sawamiphak et al., 2014
mpx	myeloid cell	Fig. 3 from Sawamiphak et al., 2014
rag1	common lymphoid progenitor thymus	Fig. 3 from Sawamiphak et al., 2014
runx1	angioblastic mesenchymal cell hematopoietic stem cell	Fig. 1 , Fig. 3 from Sawamiphak et al., 2014

Phenotype

Phenotype resulting from MO1-ifng1

Phenotype	Fish	Figures
defense response to bacterium disrupted, abnormal	WT + MO1-ifng1	text only from Sieger et al., 2009
endothelial cell cell population proliferation increased rate, abnormal	la2Tg; s896Tg + MO1-ifng1	Fig. S4 from Sawamiphak et al., 2014
hematopoietic stem cell decreased amount, abnormal	la2Tg; s896Tg + MO1-ifng1	Fig. 1 from Sawamiphak et al., 2014
ventral wall of dorsal aorta has fewer parts of type hematopoietic stem cell, abnormal	la2Tg; s896Tg + MO1-ifng1	Fig. 1 from Sawamiphak et al., 2014

Phenotype of all Fish created by or utilizing MO1-ifng1

Phenotype	Fish	Conditions	Figures
defense response to bacterium disrupted, abnormal	WT + MO1-ifng1	bacterial treatment by injection: Yersinia ruckeri	Fig. 5 from Sieger et al., 2009
whole organism viability, abnormal	WT + MO1-ifng1	bacterial treatment by injection: Yersinia ruckeri	Fig. 5 from Sieger et al., 2009
defense response to bacterium disrupted, abnormal	WT + MO1-ifng1	standard conditions	text only from Sieger et al., 2009
endothelial cell cell population proliferation increased rate, abnormal	la2Tg; s896Tg + MO1-ifng1	standard conditions	Fig. S4 from Sawamiphak et al., 2014
ventral wall of dorsal aorta has fewer parts of type hematopoietic stem cell, abnormal	la2Tg; s896Tg + MO1-ifng1	standard conditions	Fig. 1 from Sawamiphak et al., 2014
hematopoietic stem cell decreased amount, abnormal	la2Tg; s896Tg + MO1-ifng1	standard conditions	Fig. 1 from Sawamiphak et al., 2014
whole organism decreased life span, abnormal	AB + MO1-ifng1 + MO1-ifng1r	bacterial treatment: Yersinia ruckeri	Fig. 3 from Aggad et al., 2010
whole organism viability, abnormal	WT + MO1-ifng1 + MO1-ifng1r	bacterial treatment by injection: Yersinia ruckeri	Fig. 5 from Sieger et al., 2009
whole organism viability, abnormal	WT + MO1-ifng1 + MO1-ifng1r	bacterial treatment by injection: Escherichia coli DH5[alpha]	Fig. 5 from Sieger et al., 2009
defense response to bacterium disrupted, abnormal	WT + MO1-ifng1 + MO1-ifng1r	bacterial treatment by injection: Yersinia ruckeri	Fig. 5 from Sieger et al., 2009
defense response to bacterium disrupted, abnormal	WT + MO1-ifng1 + MO1-ifng1r	bacterial treatment by injection: Escherichia coli DH5[alpha]	Fig. 5 from Sieger et al., 2009
ventral wall of dorsal aorta has fewer parts of type hematopoietic stem cell, abnormal	kca3Tg; kca4Tg; la2Tg; s939Tg + MO1-ifng1	heat shock	Fig. 4 from Sawamiphak et al., 2014

Citations