Morpholino

MO1-appb

ID
ZDB-MRPHLNO-100414-5
Name
MO1-appb
Previous Names
  • appb-MO (1)
Target
Sequence
5' - TGTGTTCCCAAGCGCAGCACGTCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation blocking, targets 5"UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-appb
Expressed Gene Anatomy Figures
pcdh8 Fig. 5 with image from Joshi et al., 2009
shha Fig. 3 with image from Joshi et al., 2009
tpma Fig. 5 with image from Joshi et al., 2009
Phenotype
Phenotype resulting from MO1-appb
Phenotype Fish Figures
caudal fin curled, abnormal WT + MO1-appb Fig. 3 with image,  Fig. 4 with image from Joshi et al., 2009
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-appb Fig. 5 with image from Joshi et al., 2009
facial nerve motor nucleus axon decreased length, abnormal rw0Tg + MO1-appb Fig. 2 with image from Song et al., 2012
myotome increased width, abnormal WT + MO1-appb Fig. 5 with image from Joshi et al., 2009
neuron projection development disrupted, abnormal rw0Tg + MO1-appb Fig. 2 with image from Song et al., 2012
notochord undulate, abnormal WT + MO1-appb Fig. 3 with image,  Fig. 4 with image from Joshi et al., 2009
post-vent region decreased length, abnormal WT + MO1-appb Fig. 3 with image,  Fig. 4 with image from Joshi et al., 2009
somite deformed, abnormal WT + MO1-appb Fig. 3 with image,  Fig. 5 with image from Joshi et al., 2009
somite increased width, abnormal WT + MO1-appb Fig. 5 with image from Joshi et al., 2009
trigeminal motor nucleus axon decreased length, abnormal rw0Tg + MO1-appb Fig. 2 with image from Song et al., 2012
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-appb Fig. 4 with image from Joshi et al., 2009
yolk decreased size, abnormal WT + MO1-appb Fig. 3 with image from Joshi et al., 2009
Phenotype of all Fish created by or utilizing MO1-appb
Phenotype Fish Conditions Figures
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-appb standard conditions Fig. 4 with image from Joshi et al., 2009
myotome increased width, abnormal WT + MO1-appb standard conditions Fig. 5 with image from Joshi et al., 2009
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-appb standard conditions Fig. 5 with image from Joshi et al., 2009
caudal fin curled, abnormal WT + MO1-appb standard conditions Fig. 3 with image,  Fig. 4 with image from Joshi et al., 2009
post-vent region decreased length, abnormal WT + MO1-appb standard conditions Fig. 3 with image,  Fig. 4 with image from Joshi et al., 2009
somite deformed, abnormal WT + MO1-appb standard conditions Fig. 3 with image,  Fig. 5 with image from Joshi et al., 2009
notochord undulate, abnormal WT + MO1-appb standard conditions Fig. 3 with image,  Fig. 4 with image from Joshi et al., 2009
somite increased width, abnormal WT + MO1-appb standard conditions Fig. 5 with image from Joshi et al., 2009
yolk decreased size, abnormal WT + MO1-appb standard conditions Fig. 3 with image from Joshi et al., 2009
facial nerve motor nucleus axon decreased length, abnormal rw0Tg + MO1-appb standard conditions Fig. 2 with image from Song et al., 2012
trigeminal motor nucleus axon decreased length, abnormal rw0Tg + MO1-appb standard conditions Fig. 2 with image from Song et al., 2012
neuron projection development disrupted, abnormal rw0Tg + MO1-appb standard conditions Fig. 2 with image from Song et al., 2012
caudal fin decreased length, abnormal WT + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Joshi et al., 2009
caudal fin curled, abnormal WT + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Joshi et al., 2009
eye decreased size, abnormal WT + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Joshi et al., 2009
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Joshi et al., 2009
notochord bifurcated, abnormal WT + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Joshi et al., 2009
notochord development disrupted, abnormal WT + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Joshi et al., 2009
post-vent region decreased length, abnormal WT + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Joshi et al., 2009
endodermal cell mislocalised laterally, abnormal WT + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Joshi et al., 2009
myotome increased width, abnormal WT + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Joshi et al., 2009
notochord undulate, abnormal WT + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Joshi et al., 2009
somite increased width, abnormal WT + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Joshi et al., 2009
notochord increased width, abnormal WT + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Joshi et al., 2009
central artery shortened, abnormal s843Tg + MO1-appa + MO1-appb standard conditions Fig. 2 with image,  Fig. 3 with image from Luna et al., 2013
central artery decreased branchiness, abnormal s843Tg + MO1-appa + MO1-appb standard conditions Fig. 2 with image,  Fig. 3 with image from Luna et al., 2013
central artery decreased length, abnormal s843Tg + MO1-appa + MO1-appb standard conditions Fig. 2 with image,  Fig. 3 with image from Luna et al., 2013
ball increased size, abnormal s843Tg + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Luna et al., 2013
whole organism shortened, abnormal s843Tg + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Luna et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.