ZFIN ID: ZDB-MRPHLNO-100330-1
Morpholino Name: MO3-ihhb
Target: ihhb (1)
Previous Name: ehh-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CGTGGAGAGTCTCATGCCAACCGGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-ihhb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-ihhb No data available
PHENOTYPE
Phenotype resulting from MO3-ihhb
No data available

Phenotype of all Fish created by or utilizing MO3-ihhb
Phenotype Fish Conditions Figures
somite U-shaped, abnormal WT + MO3-ihhb + MO3-shha + MO3-shhb standard conditions Fig. 2 from Lam et al., 2003
locus coeruleus neuron decreased amount, abnormal WT + MO3-ihhb + MO3-shha + MO3-shhb standard conditions Fig. 2 from Lam et al., 2003
pericardium edematous, abnormal WT + MO3-ihhb + MO3-shha + MO3-shhb standard conditions Fig. 2 from Lam et al., 2003
blood circulation disrupted, abnormal WT + MO3-ihhb + MO3-shha + MO3-shhb standard conditions Fig. 2 from Lam et al., 2003
OTHER MO3-ihhb MORPHOLINO PAGESNo links to external sites
CITATIONS (1)