Morpholino

MO1-cops6

ID
ZDB-MRPHLNO-100226-6
Name
MO1-cops6
Previous Names
None
Target
Sequence
5' - CGGTCACACCAGACGCCATCACACT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cops6
Phenotype
Phenotype resulting from MO1-cops6
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal AB + MO1-cops6 Fig. 6 with image from Tse et al., 2011
axis specification disrupted, abnormal AB + MO1-cops6 Fig. S4 from Tse et al., 2009
central nervous system necrotic, abnormal AB + MO1-cops6 Fig. S4 from Tse et al., 2009
ethmoid cartilage absent, abnormal AB + MO1-cops6 Fig. 4 from Tse, 2017
extension aplastic, abnormal AB + MO1-cops6 Fig. S4 from Tse et al., 2009
eye decreased size, abnormal AB + MO1-cops6 Fig. S4 from Tse et al., 2009
head decreased size, abnormal AB + MO1-cops6 Fig. S4 from Tse et al., 2009
hindbrain malformed, abnormal AB + MO1-cops6 Fig. 5 with image from Tse et al., 2011
mandibular arch skeleton decreased size, abnormal AB + MO1-cops6 Fig. 4 from Tse, 2017
midbrain decreased size, abnormal AB + MO1-cops6 Fig. 5 with image from Tse et al., 2011
midbrain hindbrain boundary decreased distance otic vesicle, abnormal AB + MO1-cops6 Fig. 4 with image from Tse et al., 2011
midbrain hindbrain boundary decreased size, abnormal AB + MO1-cops6 Fig. 5 with image from Tse et al., 2011
notochord decreased length, abnormal AB + MO1-cops6 Fig. S4 from Tse et al., 2009
otic vesicle increased distance otic vesicle, abnormal AB + MO1-cops6 Fig. 4 with image from Tse et al., 2011
pericardium edematous, abnormal AB + MO1-cops6 Fig. S4 from Tse et al., 2009
pharyngeal arch cartilage malformed, abnormal AB + MO1-cops6 Fig. 4 from Tse, 2017
somite fused with somite, abnormal AB + MO1-cops6 Fig. S4 from Tse et al., 2009
whole organism decreased size, abnormal AB + MO1-cops6 Fig. S4 from Tse et al., 2009
whole organism wholly dorsalized, abnormal AB + MO1-cops6 Fig. 3 with image from Tse et al., 2011
Phenotype of all Fish created by or utilizing MO1-cops6
Phenotype Fish Conditions Figures
pericardium edematous, abnormal AB + MO1-cops6 standard conditions Fig. S4 from Tse et al., 2009
otic vesicle increased distance otic vesicle, abnormal AB + MO1-cops6 standard conditions Fig. 4 with image from Tse et al., 2011
notochord decreased length, abnormal AB + MO1-cops6 standard conditions Fig. S4 from Tse et al., 2009
midbrain decreased size, abnormal AB + MO1-cops6 standard conditions Fig. 5 with image from Tse et al., 2011
midbrain hindbrain boundary decreased size, abnormal AB + MO1-cops6 standard conditions Fig. 5 with image from Tse et al., 2011
head decreased size, abnormal AB + MO1-cops6 standard conditions Fig. S4 from Tse et al., 2009
somite fused with somite, abnormal AB + MO1-cops6 standard conditions Fig. S4 from Tse et al., 2009
extension aplastic, abnormal AB + MO1-cops6 standard conditions Fig. S4 from Tse et al., 2009
whole organism wholly dorsalized, abnormal AB + MO1-cops6 standard conditions Fig. 3 with image from Tse et al., 2011
hindbrain malformed, abnormal AB + MO1-cops6 standard conditions Fig. 5 with image from Tse et al., 2011
whole organism decreased size, abnormal AB + MO1-cops6 standard conditions Fig. S4 from Tse et al., 2009
ethmoid cartilage absent, abnormal AB + MO1-cops6 standard conditions Fig. 4 from Tse, 2017
apoptotic process increased occurrence, abnormal AB + MO1-cops6 standard conditions Fig. 6 with image from Tse et al., 2011
pharyngeal arch cartilage malformed, abnormal AB + MO1-cops6 standard conditions Fig. 4 from Tse, 2017
axis specification disrupted, abnormal AB + MO1-cops6 standard conditions Fig. S4 from Tse et al., 2009
mandibular arch skeleton decreased size, abnormal AB + MO1-cops6 standard conditions Fig. 4 from Tse, 2017
eye decreased size, abnormal AB + MO1-cops6 standard conditions Fig. S4 from Tse et al., 2009
midbrain hindbrain boundary decreased distance otic vesicle, abnormal AB + MO1-cops6 standard conditions Fig. 4 with image from Tse et al., 2011
central nervous system necrotic, abnormal AB + MO1-cops6 standard conditions Fig. S4 from Tse et al., 2009
Citations