ZFIN ID: ZDB-MRPHLNO-100226-10
Morpholino Name: MO1-mpnd
Target: mpnd (1)
Sequence:
5' - GCTCTGAGCCCATTTCGCGATAATC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-mpnd No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-mpnd No data available
PHENOTYPE
Phenotype resulting from MO1-mpnd
Phenotype of all Fish created by or utilizing MO1-mpnd
Genome Resources:
CITATIONS (1)