header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100215-4
Morpholino Name: MO1-usp2a
Target: usp2a (1)
Sequence:
5' - TGTCACTGTATATGAATGTCGCATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-usp2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-usp2a No data available
PHENOTYPE
Phenotype resulting from MO1-usp2a
No data available

Phenotype of all Fish created by or utilizing MO1-usp2a
No data available
OTHER MO1-usp2a MORPHOLINO PAGES No links to external sites
CITATIONS (1)