ZFIN ID: ZDB-MRPHLNO-100205-1
Morpholino Name: MO1-bdnf
Target: bdnf (1)
Sequence:
5' - CCAGTCGTAAAGGAGACCATTCAGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-bdnf No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-bdnf
Expressed Gene Anatomy Figures
bdnf Fig. 3 from Diekmann et al., 2009
PHENOTYPE
Phenotype resulting from MO1-bdnf
Phenotype Figures
activation of cysteine-type endopeptidase activity involved in apoptotic process increased occurrence, abnormal Fig. 4 from Diekmann et al., 2009
cranial nerve II aplastic, abnormal Fig. 4 from Diekmann et al., 2009
eye decreased size, abnormal Fig. 4 from Diekmann et al., 2009
head decreased size, abnormal Fig. 4 from Diekmann et al., 2009
locomotion decreased process quality, abnormal text only from Shimada et al., 2012
pericardium swollen, abnormal text only from Shimada et al., 2012
swim bladder aplastic, abnormal Fig. 4 from Diekmann et al., 2009
ventral mandibular arch malformed, abnormal Fig. 4 from Diekmann et al., 2009
ventricular system increased size, abnormal Fig. 4 from Diekmann et al., 2009

Phenotype of all Fish created by or utilizing MO1-bdnf
Phenotype Fish Conditions Figures
head decreased size, abnormal AB + MO1-bdnf standard conditions Fig. 4 from Diekmann et al., 2009
activation of cysteine-type endopeptidase activity involved in apoptotic process increased occurrence, abnormal AB + MO1-bdnf standard conditions Fig. 4 from Diekmann et al., 2009
ventricular system increased size, abnormal AB + MO1-bdnf standard conditions Fig. 4 from Diekmann et al., 2009
ventral mandibular arch malformed, abnormal AB + MO1-bdnf standard conditions Fig. 4 from Diekmann et al., 2009
eye decreased size, abnormal AB + MO1-bdnf standard conditions Fig. 4 from Diekmann et al., 2009
swim bladder aplastic, abnormal AB + MO1-bdnf standard conditions Fig. 4 from Diekmann et al., 2009
cranial nerve II aplastic, abnormal AB + MO1-bdnf standard conditions Fig. 4 from Diekmann et al., 2009
pericardium swollen, abnormal WT + MO1-bdnf standard conditions text only from Shimada et al., 2012
locomotion decreased process quality, abnormal WT + MO1-bdnf standard conditions text only from Shimada et al., 2012
Rohon-Beard neuron axon decreased length, abnormal WT + MO1-bdnf + MO3-mecp2 standard conditions Fig. 8 from Nozawa et al., 2017
Rohon-Beard neuron axon decreased branchiness, abnormal WT + MO1-bdnf + MO3-mecp2 standard conditions Fig. 8 from Nozawa et al., 2017
thigmotaxis disrupted, abnormal WT + MO1-bdnf + MO3-mecp2 standard conditions Fig. 8 from Nozawa et al., 2017
OTHER MO1-bdnf MORPHOLINO PAGESNo links to external sites
CITATIONS (3)