Morpholino

MO2-lmx1bb

ID

ZDB-MRPHLNO-091218-7

Name

MO2-lmx1bb

Previous Names

MO2-lmx1b.1
lmx1b.1-splice (1)

Target

lmx1bb (1)

Sequence

5' - TTGAAGGACTTACCGAGCATAACTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-lmx1bb

No data available

Phenotype

Phenotype resulting from MO2-lmx1bb

Phenotype	Fish	Figures
otic vesicle protrusion malformed, abnormal	AB + MO2-lmx1bb	Fig. 4 from Obholzer et al., 2012
otic vesicle protrusion shape, abnormal	AB + MO2-lmx1bb	Fig. 4 from Obholzer et al., 2012

Phenotype of all Fish created by or utilizing MO2-lmx1bb

Phenotype	Fish	Conditions	Figures
otic vesicle protrusion shape, abnormal	AB + MO2-lmx1bb	standard conditions	Fig. 4 from Obholzer et al., 2012
otic vesicle protrusion malformed, abnormal	AB + MO2-lmx1bb	standard conditions	Fig. 4 from Obholzer et al., 2012
optic fissure closure incomplete, abnormal	WT + MO2-lmx1bb + MO3-lmx1ba	standard conditions	Fig. 2 from McMahon et al., 2009
retina development in camera-type eye disrupted, abnormal	WT + MO2-lmx1bb + MO3-lmx1ba	chemical treatment: SU5402	Fig. 11 from McMahon et al., 2009
retinal pigmented epithelium decreased thickness, abnormal	WT + MO2-lmx1bb + MO3-lmx1ba	standard conditions	Fig. 2 from McMahon et al., 2009
midbrain hindbrain boundary apoptotic, abnormal	WT + MO2-lmx1bb + MO3-lmx1ba	standard conditions	Fig. 3 from McMahon et al., 2009
eye ventral region disorganized, abnormal	WT + MO2-lmx1bb + MO3-lmx1ba	standard conditions	Fig. 2 from McMahon et al., 2009
retina development in camera-type eye disrupted, abnormal	WT + MO2-lmx1bb + MO3-lmx1ba	standard conditions	Fig. 11 from McMahon et al., 2009
retina layer formation delayed, abnormal	WT + MO2-lmx1bb + MO3-lmx1ba	standard conditions	Fig. 2 from McMahon et al., 2009
retinal pigmented epithelium disorganized, abnormal	WT + MO2-lmx1bb + MO3-lmx1ba	standard conditions	Fig. 2 from McMahon et al., 2009
periocular mesenchyme organization quality, abnormal	WT + MO2-lmx1bb + MO3-lmx1ba	standard conditions	Fig. 2 from McMahon et al., 2009
periocular mesenchyme apoptotic, abnormal	WT + MO2-lmx1bb + MO3-lmx1ba	standard conditions	Fig. 3 from McMahon et al., 2009
presumptive neural retina decreased thickness, abnormal	WT + MO2-lmx1bb + MO3-lmx1ba	standard conditions	Fig. 2 from McMahon et al., 2009
eye morphogenesis disrupted, abnormal	WT + MO2-lmx1bb + MO3-lmx1ba	standard conditions	Fig. 2 from McMahon et al., 2009
retina development in camera-type eye disrupted, abnormal	fgf8a^{ti282a/ti282a} + MO2-lmx1bb + MO3-lmx1ba	standard conditions	Fig. 11 from McMahon et al., 2009
eye ventral region apoptotic, abnormal	ir937Tg + MO2-lmx1bb + MO3-lmx1ba	standard conditions	Fig. 3 from McMahon et al., 2009
eye morphogenesis disrupted, abnormal	mw11Tg + MO2-lmx1bb + MO3-lmx1ba	standard conditions	Fig. 7 from McMahon et al., 2009
cell migration disrupted, abnormal	mw11Tg + MO2-lmx1bb + MO3-lmx1ba	standard conditions	Fig. 7 from McMahon et al., 2009
apoptotic process increased occurrence, abnormal	mw11Tg + MO2-lmx1bb + MO3-lmx1ba	standard conditions	Fig. 5 from McMahon et al., 2009
eye decreased size, abnormal	vu119Tg + MO2-lmx1bb + MO3-lmx1ba	standard conditions	Fig. 3 from McMahon et al., 2009
eye morphogenesis disrupted, abnormal	vu119Tg + MO2-lmx1bb + MO3-lmx1ba	standard conditions	Fig. 3 from McMahon et al., 2009

Citations