ZFIN ID: ZDB-MRPHLNO-091218-3
Morpholino Name: MO2-tyrp1a
Target: tyrp1a (1)
Previous Name: MO Dre_tyrp1a_ATG (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GAACAGCTCCATAAAGTCCAAACAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-tyrp1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-tyrp1a No data available
PHENOTYPE
Phenotype resulting from MO2-tyrp1a
No data available

Phenotype of all Fish created by or utilizing MO2-tyrp1a
Phenotype Fish Conditions Figures
retinal pigmented epithelium brown, abnormal WT + MO2-tyrp1a + MO2-tyrp1b standard conditions Fig. S3 from Braasch et al., 2009
melanocyte brown, abnormal WT + MO2-tyrp1a + MO2-tyrp1b standard conditions Fig. S3 from Braasch et al., 2009
OTHER MO2-tyrp1a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)