ZFIN ID: ZDB-MRPHLNO-091218-1
Morpholino Name: MO1-tyrp1b
Target: tyrp1b (1)
Previous Name: MO Dre_tyrp1b_e2i2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGATGTTTATCCTCACCCACGGTGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-tyrp1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-tyrp1b No data available
PHENOTYPE
Phenotype resulting from MO1-tyrp1b
No data available

Phenotype of all Fish created by or utilizing MO1-tyrp1b
Phenotype Fish Conditions Figures
melanocyte brown, abnormal WT + MO1-tyrp1a + MO1-tyrp1b standard conditions Fig. 5 from Braasch et al., 2009
retinal pigmented epithelium melanocyte decreased size, abnormal WT + MO1-tyrp1a + MO1-tyrp1b standard conditions Fig. 6 from Braasch et al., 2009
retinal pigmented epithelium brown, abnormal WT + MO1-tyrp1a + MO1-tyrp1b standard conditions Fig. 5 from Braasch et al., 2009
retinal pigmented epithelium melanocyte deformed, abnormal WT + MO1-tyrp1a + MO1-tyrp1b standard conditions Fig. 6 from Braasch et al., 2009
melanocyte colorless, abnormal WT + MO1-tyrp1a + MO1-tyrp1b standard conditions Fig. 5 from Braasch et al., 2009
dermis melanocyte deformed, abnormal WT + MO1-tyrp1a + MO1-tyrp1b standard conditions Fig. 6 from Braasch et al., 2009
dermis melanocyte decreased size, abnormal WT + MO1-tyrp1a + MO1-tyrp1b standard conditions Fig. 6 from Braasch et al., 2009
OTHER MO1-tyrp1b MORPHOLINO PAGESNo links to external sites
CITATIONS (1)