ZFIN ID: ZDB-MRPHLNO-091217-5
Morpholino Name: MO1-tyrp1a
Target: tyrp1a (1)
Previous Name: MO Dre_tyrp1a_e1i1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ATCGGCCACAGTCACTTACCCACGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-tyrp1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-tyrp1a No data available
PHENOTYPE
Phenotype resulting from MO1-tyrp1a
No data available

Phenotype of all Fish created by or utilizing MO1-tyrp1a
Phenotype Fish Conditions Figures
retinal pigmented epithelium melanocyte deformed, abnormal WT + MO1-tyrp1a + MO1-tyrp1b standard conditions Fig. 6 from Braasch et al., 2009
melanocyte colorless, abnormal WT + MO1-tyrp1a + MO1-tyrp1b standard conditions Fig. 5 from Braasch et al., 2009
dermis melanocyte deformed, abnormal WT + MO1-tyrp1a + MO1-tyrp1b standard conditions Fig. 6 from Braasch et al., 2009
dermis melanocyte decreased size, abnormal WT + MO1-tyrp1a + MO1-tyrp1b standard conditions Fig. 6 from Braasch et al., 2009
melanocyte brown, abnormal WT + MO1-tyrp1a + MO1-tyrp1b standard conditions Fig. 5 from Braasch et al., 2009
retinal pigmented epithelium melanocyte decreased size, abnormal WT + MO1-tyrp1a + MO1-tyrp1b standard conditions Fig. 6 from Braasch et al., 2009
retinal pigmented epithelium brown, abnormal WT + MO1-tyrp1a + MO1-tyrp1b standard conditions Fig. 5 from Braasch et al., 2009
retinal pigmented epithelium zinc atom decreased amount, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 2 with image from Takamiya et al., 2016
retinal pigmented epithelium melanocyte absent, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 2 with image from Takamiya et al., 2016
lens reflectivity, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 3 with image from Takamiya et al., 2016
retinal pigmented epithelium selenium atom decreased amount, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 2 with image from Takamiya et al., 2016
retinal pigmented epithelium strontium atom decreased amount, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 2 with image from Takamiya et al., 2016
retinal pigmented epithelium potassium atom decreased amount, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 2 with image from Takamiya et al., 2016
melanoblast cell maturation arrested, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 2 with image from Takamiya et al., 2016
lens structure, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 3 with image from Takamiya et al., 2016
retinal pigmented epithelium bromine atom decreased amount, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 2 with image from Takamiya et al., 2016
retinal pigmented epithelium calcium atom decreased amount, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 2 with image from Takamiya et al., 2016
retinal pigmented epithelium manganese atom decreased amount, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 2 with image from Takamiya et al., 2016
retinal pigmented epithelium barium atom decreased amount, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 2 with image from Takamiya et al., 2016
retinal pigmented epithelium melanins brown, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 2 with image from Takamiya et al., 2016
retinal pigmented epithelium chemical homeostasis within retina disrupted, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 2 with image from Takamiya et al., 2016
OTHER MO1-tyrp1a MORPHOLINO PAGESNo links to external sites
CITATIONS (3)