header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-091103-1
Morpholino Name: MO2-rps19
Target: rps19 (1)
Previous Name: rps19 splicing MO

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCTTCCCCGACCTTTCAAAAGACAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-rps19 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-rps19
Expressed Gene Anatomy Figures
ada Fig. 4 from Danilova et al., 2008
baxa Fig. 4 from Danilova et al., 2008
c6 Fig. 5 from Danilova et al., 2018
cdkn1a Fig. 4 from Danilova et al., 2008
cfb Fig. 5 from Danilova et al., 2018
cfh Fig. 5 from Danilova et al., 2018
fn1b Fig. 3 from Danilova et al., 2018
fsta Fig. 4 from Danilova et al., 2018
gata2a Fig. 5 from Danilova et al., 2008
gsc Fig. 5 from Danilova et al., 2008
hbae1.1 Fig. 3 from Danilova et al., 2008
ifih1 Fig. 2 from Danilova et al., 2018
il6 Fig. 3 from Danilova et al., 2018
inha Fig. 4 from Danilova et al., 2018
ins Fig. 2 from Danilova et al., 2008
irf3 Fig. 1 from Danilova et al., 2018
irf7 Fig. 1 from Danilova et al., 2018
isg15 Fig. 1 from Danilova et al., 2018
lft2 Fig. 2 from Danilova et al., 2008
mmp9 Fig. 3 from Danilova et al., 2018
ptgs2a Fig. 3 from Danilova et al., 2018
smad7 Fig. 4 from Danilova et al., 2018
socs3a Fig. 1 from Danilova et al., 2018
socs3b Fig. 1 from Danilova et al., 2018
stat1b Fig. 1 from Danilova et al., 2018
tlr1 Fig. 1Fig. 2 from Danilova et al., 2018
tlr3 Fig. 2 from Danilova et al., 2018
tlr9 Fig. 2 from Danilova et al., 2018
tnfa Fig. 3 from Danilova et al., 2018
tp53 Fig. 4 from Danilova et al., 2008
tp63 Fig. 4Fig. 5 from Danilova et al., 2008
tp73 Fig. 4 from Danilova et al., 2008
PHENOTYPE
Phenotype resulting from MO2-rps19
Phenotype Figures
blood apoptotic process increased process quality, abnormal Fig. 6 with image from Danilova et al., 2014
brain necrotic, abnormal Fig. 2 from Danilova et al., 2008
cranial cartilage malformed, abnormal Fig. 2 from Danilova et al., 2008
digestive system position, abnormal Fig. 2 from Danilova et al., 2008
embryo development arrested, abnormal Fig. 6 with image from Danilova et al., 2018
erythrocyte development disrupted, abnormal Fig. 3 from Danilova et al., 2008
erythrocyte differentiation decreased occurrence, abnormal Fig. 4 from Bibikova et al., 2014
eye aplastic, abnormal Fig. 2 from Danilova et al., 2008
eye decreased size, abnormal Fig. 6 with image from Danilova et al., 2018
Fig. 2 from Danilova et al., 2008
eye hypoplastic, abnormal Fig. 4 from Bibikova et al., 2014
forebrain aplastic, abnormal Fig. 2 from Danilova et al., 2008
forebrain decreased size, abnormal Fig. 2 from Danilova et al., 2008
head decreased size, abnormal Fig. 6 with image from Danilova et al., 2018
Fig. 2 from Danilova et al., 2008
head apoptotic process increased process quality, abnormal Fig. 6 with image from Danilova et al., 2014
heart primordium position, abnormal Fig. 2 from Danilova et al., 2008
intermediate cell mass of mesoderm erythroblast increased amount, abnormal Fig. 3 from Danilova et al., 2008
midbrain hindbrain boundary malformed, abnormal Fig. 2 from Danilova et al., 2008
nucleate erythrocyte decreased amount, abnormal Fig. 3 with image from Danilova et al., 2014
Fig. 3 from Danilova et al., 2008
optic primordium decreased size, abnormal Fig. 2 from Danilova et al., 2008
post-vent region kinked, abnormal Fig. 6 with image from Danilova et al., 2018
trunk curved, abnormal Fig. 6 with image from Danilova et al., 2018
whole organism apoptotic, abnormal Fig. 2 from Danilova et al., 2008
whole organism inha expression decreased amount, abnormal Fig. 4 from Danilova et al., 2018
whole organism decreased length, abnormal Fig. 6 with image from Danilova et al., 2018
whole organism decreased life span, abnormal Fig. 6 with image from Danilova et al., 2018
whole organism decreased size, abnormal Fig. 4 from Bibikova et al., 2014
whole organism ptgs2a expression increased amount, abnormal Fig. 3 from Danilova et al., 2018
whole organism cfb expression increased amount, abnormal Fig. 5 from Danilova et al., 2018
whole organism cfh expression increased amount, abnormal Fig. 5 from Danilova et al., 2018
whole organism il6 expression increased amount, abnormal Fig. 3 from Danilova et al., 2018
whole organism tlr3 expression increased amount, abnormal Fig. 2 from Danilova et al., 2018
whole organism tlr1 expression increased amount, abnormal Fig. 1Fig. 2 from Danilova et al., 2018
whole organism tlr9 expression increased amount, abnormal Fig. 2 from Danilova et al., 2018
whole organism ifih1 expression increased amount, abnormal Fig. 2 from Danilova et al., 2018
whole organism stat1b expression increased amount, abnormal Fig. 1 from Danilova et al., 2018
whole organism isg15 expression increased amount, abnormal Fig. 1 from Danilova et al., 2018
whole organism fsta expression increased amount, abnormal Fig. 4 from Danilova et al., 2018
whole organism tnfa expression increased amount, abnormal Fig. 3 from Danilova et al., 2018
whole organism c6 expression increased amount, abnormal Fig. 5 from Danilova et al., 2018
whole organism socs3b expression increased amount, abnormal Fig. 1 from Danilova et al., 2018
whole organism mmp9 expression increased amount, abnormal Fig. 3 from Danilova et al., 2018
whole organism socs3a expression increased amount, abnormal Fig. 1 from Danilova et al., 2018
whole organism irf7 expression increased amount, abnormal Fig. 1 from Danilova et al., 2018
whole organism irf3 expression increased amount, abnormal Fig. 1 from Danilova et al., 2018
whole organism fn1b expression increased amount, abnormal Fig. 3 from Danilova et al., 2018
whole organism smad7 expression increased amount, abnormal Fig. 4 from Danilova et al., 2018
whole organism morphology, abnormal Fig. 4 from Bibikova et al., 2014
whole organism anterior-posterior axis curved, abnormal Fig. 4 from Bibikova et al., 2014
whole organism anterior-posterior axis kinked, abnormal Fig. 4 from Bibikova et al., 2014
whole organism ribosome decreased amount, abnormal Fig. 1 from Danilova et al., 2008

Phenotype of all Fish created by or utilizing MO2-rps19
Phenotype Fish Conditions Figures
whole organism irf7 expression increased amount, abnormal AB + MO2-rps19 standard conditions Fig. 1 from Danilova et al., 2018
embryo development arrested, abnormal AB + MO2-rps19 standard conditions Fig. 6 with image from Danilova et al., 2018
whole organism ptgs2a expression increased amount, abnormal AB + MO2-rps19 standard conditions Fig. 3 from Danilova et al., 2018
whole organism tlr1 expression increased amount, abnormal AB + MO2-rps19 standard conditions Fig. 1Fig. 2 from Danilova et al., 2018
whole organism isg15 expression increased amount, abnormal AB + MO2-rps19 standard conditions Fig. 1 from Danilova et al., 2018
whole organism stat1b expression increased amount, abnormal AB + MO2-rps19 standard conditions Fig. 1 from Danilova et al., 2018
whole organism cfb expression increased amount, abnormal AB + MO2-rps19 standard conditions Fig. 5 from Danilova et al., 2018
whole organism mmp9 expression increased amount, abnormal AB + MO2-rps19 standard conditions Fig. 3 from Danilova et al., 2018
whole organism decreased length, abnormal AB + MO2-rps19 standard conditions Fig. 6 with image from Danilova et al., 2018
whole organism tlr9 expression increased amount, abnormal AB + MO2-rps19 standard conditions Fig. 2 from Danilova et al., 2018
eye decreased size, abnormal AB + MO2-rps19 standard conditions Fig. 6 with image from Danilova et al., 2018
post-vent region kinked, abnormal AB + MO2-rps19 standard conditions Fig. 6 with image from Danilova et al., 2018
whole organism fn1b expression increased amount, abnormal AB + MO2-rps19 standard conditions Fig. 3 from Danilova et al., 2018
whole organism decreased life span, abnormal AB + MO2-rps19 standard conditions Fig. 6 with image from Danilova et al., 2018
whole organism socs3b expression increased amount, abnormal AB + MO2-rps19 standard conditions Fig. 1 from Danilova et al., 2018
trunk curved, abnormal AB + MO2-rps19 standard conditions Fig. 6 with image from Danilova et al., 2018
whole organism cfh expression increased amount, abnormal AB + MO2-rps19 standard conditions Fig. 5 from Danilova et al., 2018
whole organism il6 expression increased amount, abnormal AB + MO2-rps19 standard conditions Fig. 3 from Danilova et al., 2018
whole organism inha expression decreased amount, abnormal AB + MO2-rps19 standard conditions Fig. 4 from Danilova et al., 2018
whole organism ifih1 expression increased amount, abnormal AB + MO2-rps19 standard conditions Fig. 2 from Danilova et al., 2018
whole organism socs3a expression increased amount, abnormal AB + MO2-rps19 standard conditions Fig. 1 from Danilova et al., 2018
whole organism c6 expression increased amount, abnormal AB + MO2-rps19 standard conditions Fig. 5 from Danilova et al., 2018
whole organism smad7 expression increased amount, abnormal AB + MO2-rps19 standard conditions Fig. 4 from Danilova et al., 2018
whole organism fsta expression increased amount, abnormal AB + MO2-rps19 standard conditions Fig. 4 from Danilova et al., 2018
whole organism tlr3 expression increased amount, abnormal AB + MO2-rps19 standard conditions Fig. 2 from Danilova et al., 2018
whole organism irf3 expression increased amount, abnormal AB + MO2-rps19 standard conditions Fig. 1 from Danilova et al., 2018
whole organism tnfa expression increased amount, abnormal AB + MO2-rps19 standard conditions Fig. 3 from Danilova et al., 2018
head decreased size, abnormal AB + MO2-rps19 standard conditions Fig. 6 with image from Danilova et al., 2018
nucleate erythrocyte decreased amount, abnormal WT + MO2-rps19 standard conditions Fig. 3 with image from Danilova et al., 2014
Fig. 3 from Danilova et al., 2008
whole organism apoptotic, abnormal WT + MO2-rps19 standard conditions Fig. 2 from Danilova et al., 2008
forebrain aplastic, abnormal WT + MO2-rps19 standard conditions Fig. 2 from Danilova et al., 2008
eye aplastic, abnormal WT + MO2-rps19 standard conditions Fig. 2 from Danilova et al., 2008
whole organism decreased size, abnormal WT + MO2-rps19 control Fig. 4 from Bibikova et al., 2014
heart primordium position, abnormal WT + MO2-rps19 standard conditions Fig. 2 from Danilova et al., 2008
eye decreased size, abnormal WT + MO2-rps19 standard conditions Fig. 2 from Danilova et al., 2008
whole organism anterior-posterior axis kinked, abnormal WT + MO2-rps19 control Fig. 4 from Bibikova et al., 2014
eye hypoplastic, abnormal WT + MO2-rps19 control Fig. 4 from Bibikova et al., 2014
erythrocyte differentiation decreased occurrence, abnormal WT + MO2-rps19 control Fig. 4 from Bibikova et al., 2014
midbrain hindbrain boundary malformed, abnormal WT + MO2-rps19 standard conditions Fig. 2 from Danilova et al., 2008
blood apoptotic process increased process quality, abnormal WT + MO2-rps19 standard conditions Fig. 6 with image from Danilova et al., 2014
forebrain decreased size, abnormal WT + MO2-rps19 standard conditions Fig. 2 from Danilova et al., 2008
whole organism morphology, abnormal WT + MO2-rps19 control Fig. 4 from Bibikova et al., 2014
brain necrotic, abnormal WT + MO2-rps19 standard conditions Fig. 2 from Danilova et al., 2008
digestive system position, abnormal WT + MO2-rps19 standard conditions Fig. 2 from Danilova et al., 2008
erythrocyte development disrupted, abnormal WT + MO2-rps19 standard conditions Fig. 3 from Danilova et al., 2008
optic primordium decreased size, abnormal WT + MO2-rps19 standard conditions Fig. 2 from Danilova et al., 2008
whole organism anterior-posterior axis curved, abnormal WT + MO2-rps19 control Fig. 4 from Bibikova et al., 2014
head apoptotic process increased process quality, abnormal WT + MO2-rps19 standard conditions Fig. 6 with image from Danilova et al., 2014
whole organism ribosome decreased amount, abnormal WT + MO2-rps19 standard conditions Fig. 1 from Danilova et al., 2008
head decreased size, abnormal WT + MO2-rps19 standard conditions Fig. 2 from Danilova et al., 2008
cranial cartilage malformed, abnormal WT + MO2-rps19 standard conditions Fig. 2 from Danilova et al., 2008
intermediate cell mass of mesoderm erythroblast increased amount, abnormal WT + MO2-rps19 standard conditions Fig. 3 from Danilova et al., 2008
whole organism irf7 expression increased amount, abnormal tp53zdf1/zdf1 + MO2-rps19 standard conditions Fig. 1 from Danilova et al., 2018
whole organism tlr3 expression increased amount, abnormal tp53zdf1/zdf1 + MO2-rps19 standard conditions Fig. 2 from Danilova et al., 2018
whole organism c6 expression increased amount, abnormal tp53zdf1/zdf1 + MO2-rps19 standard conditions Fig. 5 from Danilova et al., 2018
OTHER MO2-rps19 MORPHOLINO PAGESNo links to external sites
CITATIONS (4)