header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-090918-1
Morpholino Name: MO1-lnx2b
Target: lnx2b (1)
Previous Name: lnx-l 5' UTR MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CCTACGCCTCTTTCACAGCTCACAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-lnx2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-lnx2b
Expressed Gene Anatomy Figures
chrd Fig. 1 from Ro et al., 2009
dharma Fig. 5 from Ro et al., 2009
gsc Fig. 1Fig. 4Fig. 5 from Ro et al., 2009
vent Fig. 1 from Ro et al., 2009
vox Fig. 1 from Ro et al., 2009
PHENOTYPE
Phenotype resulting from MO1-lnx2b
Phenotype of all Fish created by or utilizing MO1-lnx2b
Genome Resources:
CITATIONS (2)