ZFIN ID: ZDB-MRPHLNO-090908-3
Morpholino Name: MO1-hoxb5a
Target: hoxb5a (1)
Sequence:
5' - CATATTAGCCATGGTACATACGTATT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: MO targeting the donor site of the single intron in hoxb5a efficiently abrogates splicing without affecting the hoxb5b transcript.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-hoxb5a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-hoxb5a No data available
PHENOTYPE
Phenotype resulting from MO1-hoxb5a
No data available

Phenotype of all Fish created by or utilizing MO1-hoxb5a
No data available
OTHER MO1-hoxb5a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)