header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-090828-3
Morpholino Name: MO3-col22a1
Target: col22a1 (1)
Previous Names: col9a1 MO (1), MO1-prp

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCAGAGTGTGGAGTCTCACCACTAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This morpholino was designed to block the splice site and consequently delete exon 5 and generate an early stop codon in exon 6.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-col22a1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-col22a1 No data available
PHENOTYPE
Phenotype resulting from MO3-col22a1
Phenotype of all Fish created by or utilizing MO3-col22a1
OTHER MO3-col22a1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)