ZFIN ID: ZDB-MRPHLNO-090826-7
Morpholino Name: MO4-emx3
Target: emx3 (1)
Previous Name: emx3MOi1e2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGTCGTCACCTGCAGAGAAACAAAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-emx3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-emx3 No data available
PHENOTYPE 
Phenotype resulting from MO4-emx3
No data available

Phenotype of all Fish created by or utilizing MO4-emx3
Phenotype Fish Conditions Figures
dorsal telencephalon morphology, abnormal WT + MO1-emx3 + MO4-emx3 + MO4-tp53 standard conditions Fig. 3 with image from Viktorin et al., 2009
OTHER MO4-emx3 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)