Morpholino

MO4-rap1b

ID

ZDB-MRPHLNO-090826-14

Name

MO4-rap1b

Previous Names

None

Target

Sequence

5' - AAATGATGCAGAACTTGCCTTTCTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This morpholino is designed against the rap1b exon 2 splice donor site.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO4-rap1b

Expressed Gene	Anatomy	Figures
efnb2a	artery dorsal aorta	Fig. 2 from Rho et al., 2019
runx1	ventral wall of dorsal aorta	Fig. 3 from Rho et al., 2019

Phenotype

Phenotype resulting from MO4-rap1b

Phenotype	Fish	Figures
cranial vasculature broken, abnormal	WT + MO4-rap1b	Fig. 1 from Gore et al., 2008
endothelial cell cell-cell junction absent, abnormal	WT + MO4-rap1b	Fig. 2 from Gore et al., 2008
posterior lateral plate mesoderm cell decreased adhesivity, abnormal	hzm7Et; ncv2Tg + MO4-rap1b	Fig. 4 from Rho et al., 2019
posterior lateral plate mesoderm cell morphology, abnormal	ncv2Tg + MO4-rap1b	Fig. 4 from Rho et al., 2019
posterior lateral plate mesoderm cell migration involved in vasculogenesis process quality, abnormal	ncv2Tg + MO4-rap1b	Fig. 4 from Rho et al., 2019
vascular cord EGFP expression decreased amount, abnormal	um13Tg; um14Tg + MO4-rap1b	Fig. 3 from Rho et al., 2019
vascular cord Notch signaling pathway decreased occurrence, abnormal	um13Tg; um14Tg + MO4-rap1b	Fig. 3 from Rho et al., 2019
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal	WT + MO4-rap1b	Fig. 3 from Rho et al., 2019

Phenotype of all Fish created by or utilizing MO4-rap1b

Phenotype	Fish	Conditions	Figures
endothelial cell cell-cell junction absent, abnormal	WT + MO4-rap1b	standard conditions	Fig. 2 from Gore et al., 2008
cranial vasculature broken, abnormal	WT + MO4-rap1b	standard conditions	Fig. 1 from Gore et al., 2008
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal	WT + MO4-rap1b	control	Fig. 3 from Rho et al., 2019
posterior lateral plate mesoderm cell morphology, abnormal	ncv2Tg + MO4-rap1b	control	Fig. 4 from Rho et al., 2019
posterior lateral plate mesoderm cell migration involved in vasculogenesis process quality, abnormal	ncv2Tg + MO4-rap1b	control	Fig. 4 from Rho et al., 2019
angioblast cell migration from lateral mesoderm to midline process quality, abnormal	y1Tg + MO4-rap1b	heat shock	Fig. 4 from Rho et al., 2019
posterior lateral plate mesoderm cell decreased adhesivity, abnormal	hzm7Et; ncv2Tg + MO4-rap1b	control	Fig. 4 from Rho et al., 2019
vascular cord EGFP expression decreased amount, abnormal	um13Tg; um14Tg + MO4-rap1b	control	Fig. 3 from Rho et al., 2019
vascular cord Notch signaling pathway decreased occurrence, abnormal	um13Tg; um14Tg + MO4-rap1b	control	Fig. 3 from Rho et al., 2019
ventral wall of dorsal aorta runx1 expression amount, ameliorated	kca3Tg; kca4Tg + MO4-rap1b	heat shock	Fig. 3 from Rho et al., 2019

Citations