ZFIN ID: ZDB-MRPHLNO-090826-1
Morpholino Name: MO1-emx1
Target: emx1 (1)
Previous Name: emx1MOatg (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CCGTTGCCGAGAACATTGTCCGTGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-emx1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-emx1 No data available
PHENOTYPE 
Phenotype resulting from MO1-emx1
No data available

Phenotype of all Fish created by or utilizing MO1-emx1
Phenotype Fish Conditions Figures
dorsal telencephalon morphology, abnormal WT + MO1-emx1 + MO2-emx1 + MO4-tp53 standard conditions Fig. 3 with imagetext only from Viktorin et al., 2009
dorsal telencephalon morphology, abnormal WT + MO1-emx1 + MO1-emx2 + MO2-emx1 + MO2-emx2 + MO2-emx3 + MO3-emx3 + MO4-tp53 standard conditions Fig. 3 with image from Viktorin et al., 2009
OTHER MO1-emx1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)