Morpholino

MO1-sars1

ID
ZDB-MRPHLNO-090709-1
Name
MO1-sars1
Previous Names
  • MO1-sars
Target
Sequence
5' - AGGAGAATGTGAACAAACCTGACAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sars1
Expressed Gene Anatomy Figures
vegfaa Fig. 5Fig. 7 with image from Shi et al., 2014
Fig. 6 with image from Xu et al., 2012
Phenotype
Phenotype resulting from MO1-sars1
Phenotype of all Fish created by or utilizing MO1-sars1
Phenotype Fish Conditions Figures
pericardium edematous, abnormal pku6Tg + MO1-sars standard conditions Fig. S1 from Wang et al., 2018
posterior communicating artery deformed, abnormal pku6Tg + MO1-sars standard conditions Fig. 2 with image from Wang et al., 2018
basal communicating artery fused with primordial midbrain channel, abnormal pku6Tg + MO1-sars standard conditions Fig. 2 with image from Wang et al., 2018
basal communicating artery deformed, abnormal pku6Tg + MO1-sars standard conditions Fig. 2 with image from Wang et al., 2018
basal communicating artery dilated, abnormal pku6Tg + MO1-sars standard conditions Fig. 2 with image from Wang et al., 2018
cranial division of the internal carotid artery dysplastic, abnormal pku6Tg + MO1-sars standard conditions Fig. 2 with image from Wang et al., 2018
basilar artery fused with primordial hindbrain channel, abnormal pku6Tg + MO1-sars standard conditions Fig. 2 with image from Wang et al., 2018
posterior communicating artery dilated, abnormal pku6Tg + MO1-sars standard conditions Fig. 2 with image from Wang et al., 2018
cranium edematous, abnormal pku6Tg + MO1-sars standard conditions Fig. S1 from Wang et al., 2018
whole organism vegfaa expression increased amount, abnormal y1Tg + MO1-sars standard conditions Fig. 5Fig. 7 with image from Shi et al., 2014
Fig. 6 with image from Xu et al., 2012
intersegmental vessel increased branchiness, abnormal y1Tg + MO1-sars standard conditions Fig. 5Fig. 7 with image from Shi et al., 2014
Fig. 6 with image from Xu et al., 2012
whole organism vegfaa expression amount, ameliorated y1Tg + MO1-myca + MO1-sars standard conditions Fig. 5 from Shi et al., 2014
intersegmental vessel branchiness, ameliorated y1Tg + MO1-myca + MO1-sars standard conditions Fig. 5 from Shi et al., 2014
Citations