ZFIN ID: ZDB-MRPHLNO-090630-11
Morpholino Name: MO1-itga2b
Target: itga2b (1)
Previous Name: itga2b atg1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AATTCCAGTTTCTTGTCCATCTTCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-itga2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-itga2b No data available
PHENOTYPE
Phenotype resulting from MO1-itga2b
Phenotype of all Fish created by or utilizing MO1-itga2b
Genome Resources:
CITATIONS (1)