header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-090513-9
Morpholino Name: MO1-birc5b
Target: birc5b (1)
Sequence:
5' - GAAGTCTTTTTTCATAACTATACAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-birc5b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-birc5b
Expressed Gene Anatomy Figures
bmp4 Fig. 5 with image from Delvaeye et al., 2009
ccnd1 Fig. 9 from Ko et al., 2011
cdkn1bb Fig. 9 from Ko et al., 2011
cdkn1ca Fig. 9 from Ko et al., 2011
crestin Fig. 3 with image from Delvaeye et al., 2009
elavl3 Fig. 6 from Ko et al., 2011
flt4 Fig. 3 with image from Delvaeye et al., 2009
foxd3 Fig. 5 with image from Delvaeye et al., 2009
gata1a Fig. 4 with image from Delvaeye et al., 2009
hey2 Fig. 3 with image from Delvaeye et al., 2009
isl1 Fig. 2 with image from Delvaeye et al., 2009
myh7 Fig. 5 with image from Delvaeye et al., 2009
myl7 Fig. 5 with image from Delvaeye et al., 2009
nes Fig. 9 from Ko et al., 2011
pcna Fig. 9 from Ko et al., 2011
zic1 Fig. 2 with image from Delvaeye et al., 2009
PHENOTYPE
Phenotype resulting from MO1-birc5b
Phenotype Figures
aortic arch hypoplastic, abnormal Fig. 3 with image from Delvaeye et al., 2009
atrioventricular valve decreased diameter, abnormal Fig. 5 with image from Delvaeye et al., 2009
axial vasculature apoptotic, abnormal Fig. 6 with image from Delvaeye et al., 2009
axial vasculature decreased diameter, abnormal Fig. 3 with image from Delvaeye et al., 2009
brain decreased size, abnormal Fig. 2 with image from Delvaeye et al., 2009
cardiac ventricle decreased size, abnormal Fig. 5 with image from Delvaeye et al., 2009
caudal vein plexus apoptotic, abnormal Fig. 6 with image from Delvaeye et al., 2009
caudal vein plexus morphology, abnormal Fig. 3 with imageFig. 8 with image from Delvaeye et al., 2009
caudal vein plexus proliferative region decreased functionality, abnormal Fig. 7 with image from Delvaeye et al., 2009
cell population proliferation decreased occurrence, abnormal Fig. 7 with image from Delvaeye et al., 2009
endocardial ring decreased size, abnormal Fig. 5 with image from Delvaeye et al., 2009
erythrocyte differentiation disrupted, abnormal Fig. 4 with image from Delvaeye et al., 2009
G1 to G0 transition disrupted, abnormal Fig. 9 from Ko et al., 2011
head decreased size, abnormal Fig. 6Fig. 9 from Ko et al., 2011
Fig. 2 with image from Delvaeye et al., 2009
head motor neuron disorganized, abnormal Fig. 2 with image from Delvaeye et al., 2009
hemopoiesis decreased occurrence, abnormal Fig. 7 with image from Delvaeye et al., 2009
lateral plate mesoderm angioblastic mesenchymal cell cellular motility, abnormal Fig. 3 with image from Delvaeye et al., 2009
neural tube proliferative region decreased functionality, abnormal Fig. 7 with image from Delvaeye et al., 2009
neuron apoptotic process increased occurrence, abnormal Fig. 6 from Ko et al., 2011
neuron differentiation disrupted, abnormal Fig. 6Fig. 9 from Ko et al., 2011
nucleate erythrocyte decreased amount, abnormal Fig. 4 with image from Delvaeye et al., 2009
posterior neural tube apoptotic, abnormal Fig. 6 with image from Delvaeye et al., 2009
sinus venosus decreased functionality, abnormal Fig. 2 with image from Delvaeye et al., 2009
sinus venosus increased accumulation blood, abnormal Fig. 2 with image from Delvaeye et al., 2009

Phenotype of all Fish created by or utilizing MO1-birc5b
Phenotype Fish Conditions Figures
sinus venosus decreased functionality, abnormal WT + MO1-birc5b standard conditions Fig. 2 with image from Delvaeye et al., 2009
atrioventricular valve decreased diameter, abnormal WT + MO1-birc5b standard conditions Fig. 5 with image from Delvaeye et al., 2009
neuron apoptotic process increased occurrence, abnormal WT + MO1-birc5b standard conditions Fig. 6 from Ko et al., 2011
endocardial ring decreased size, abnormal WT + MO1-birc5b standard conditions Fig. 5 with image from Delvaeye et al., 2009
axial vasculature apoptotic, abnormal WT + MO1-birc5b standard conditions Fig. 6 with image from Delvaeye et al., 2009
posterior neural tube apoptotic, abnormal WT + MO1-birc5b standard conditions Fig. 6 with image from Delvaeye et al., 2009
cell population proliferation decreased occurrence, abnormal WT + MO1-birc5b standard conditions Fig. 7 with image from Delvaeye et al., 2009
caudal vein plexus proliferative region decreased functionality, abnormal WT + MO1-birc5b standard conditions Fig. 7 with image from Delvaeye et al., 2009
hemopoiesis decreased occurrence, abnormal WT + MO1-birc5b standard conditions Fig. 7 with image from Delvaeye et al., 2009
neural tube proliferative region decreased functionality, abnormal WT + MO1-birc5b standard conditions Fig. 7 with image from Delvaeye et al., 2009
sinus venosus increased accumulation blood, abnormal WT + MO1-birc5b standard conditions Fig. 2 with image from Delvaeye et al., 2009
caudal vein plexus apoptotic, abnormal WT + MO1-birc5b standard conditions Fig. 6 with image from Delvaeye et al., 2009
head decreased size, abnormal WT + MO1-birc5b standard conditions Fig. 6Fig. 9 from Ko et al., 2011
Fig. 2 with image from Delvaeye et al., 2009
head motor neuron disorganized, abnormal WT + MO1-birc5b standard conditions Fig. 2 with image from Delvaeye et al., 2009
neuron differentiation disrupted, abnormal WT + MO1-birc5b standard conditions Fig. 6Fig. 9 from Ko et al., 2011
G1 to G0 transition disrupted, abnormal WT + MO1-birc5b standard conditions Fig. 9 from Ko et al., 2011
brain decreased size, abnormal WT + MO1-birc5b standard conditions Fig. 2 with image from Delvaeye et al., 2009
cardiac ventricle decreased size, abnormal WT + MO1-birc5b standard conditions Fig. 5 with image from Delvaeye et al., 2009
erythrocyte differentiation disrupted, abnormal WT + MO1-birc5b standard conditions Fig. 4 with image from Delvaeye et al., 2009
nucleate erythrocyte decreased amount, abnormal WT + MO1-birc5b standard conditions Fig. 4 with image from Delvaeye et al., 2009
aortic arch hypoplastic, abnormal la116Tg + MO1-birc5b standard conditions Fig. 3 with image from Delvaeye et al., 2009
axial vasculature decreased diameter, abnormal y1Tg + MO1-birc5b standard conditions Fig. 3 with image from Delvaeye et al., 2009
caudal vein plexus morphology, abnormal y1Tg + MO1-birc5b standard conditions Fig. 3 with imageFig. 8 with image from Delvaeye et al., 2009
lateral plate mesoderm angioblastic mesenchymal cell cellular motility, abnormal y1Tg + MO1-birc5b standard conditions Fig. 3 with image from Delvaeye et al., 2009
Genome Resources:
CITATIONS (2)