Morpholino

MO3-foxj1a

ID
ZDB-MRPHLNO-090513-1
Name
MO3-foxj1a
Previous Names
  • foxj1a-MO1 (1)
Target
Sequence
5' - AATGTTATCCGTTTTCTTCCAGCG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Designed to target the 5' UTR region of foxj1a to block normal translation of the protein.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-foxj1a
Expressed Gene Anatomy Figures
cp Fig. 1 from Tian et al., 2009
lft2 Fig. 1,  Fig. 2 from Tian et al., 2009
pitx2 Fig. 1,  Fig. 2 from Tian et al., 2009
spaw Fig. 1,  Fig. 2 from Tian et al., 2009
tpm4a Fig. 1,  Fig. 2 from Tian et al., 2009
Phenotype
Phenotype resulting from MO3-foxj1a
Phenotype Fish Figures
determination of left/right symmetry disrupted, abnormal TU + MO3-foxj1a Fig. 1,  Fig. 2 from Tian et al., 2009
heart centered, abnormal TU + MO3-foxj1a Fig. 1,  Fig. 2 from Tian et al., 2009
heart right side of whole organism anterior-posterior axis, abnormal TU + MO3-foxj1a Fig. 1,  Fig. 2 from Tian et al., 2009
heart jogging disrupted, abnormal TU + MO3-foxj1a Fig. 1,  Fig. 2 from Tian et al., 2009
heart looping disrupted, abnormal TU + MO3-foxj1a Fig. 1,  Fig. 2 from Tian et al., 2009
heart rudiment bilateral, abnormal TU + MO3-foxj1a Fig. 1,  Fig. 2 from Tian et al., 2009
heart rudiment right side of whole organism anterior-posterior axis, abnormal TU + MO3-foxj1a Fig. 1,  Fig. 2 from Tian et al., 2009
liver bilateral, abnormal TU + MO3-foxj1a Fig. 1 from Tian et al., 2009
liver right side of whole organism anterior-posterior axis, abnormal TU + MO3-foxj1a Fig. 1 from Tian et al., 2009
musculoskeletal movement disrupted, abnormal TU + MO3-foxj1a Fig. S3 from Tian et al., 2009
whole organism bent, abnormal TU + MO3-foxj1a Fig. S3 from Tian et al., 2009
whole organism circling, abnormal TU + MO3-foxj1a Fig. S3 from Tian et al., 2009
whole organism curved ventral, abnormal TU + MO3-foxj1a Fig. S3 from Tian et al., 2009
Phenotype of all Fish created by or utilizing MO3-foxj1a
Phenotype Fish Conditions Figures
musculoskeletal movement disrupted, abnormal TU + MO3-foxj1a standard conditions Fig. S3 from Tian et al., 2009
liver right side of whole organism anterior-posterior axis, abnormal TU + MO3-foxj1a standard conditions Fig. 1 from Tian et al., 2009
liver bilateral, abnormal TU + MO3-foxj1a standard conditions Fig. 1 from Tian et al., 2009
whole organism bent, abnormal TU + MO3-foxj1a standard conditions Fig. S3 from Tian et al., 2009
heart right side of whole organism anterior-posterior axis, abnormal TU + MO3-foxj1a standard conditions Fig. 1,  Fig. 2 from Tian et al., 2009
heart looping disrupted, abnormal TU + MO3-foxj1a standard conditions Fig. 1,  Fig. 2 from Tian et al., 2009
heart rudiment bilateral, abnormal TU + MO3-foxj1a standard conditions Fig. 1,  Fig. 2 from Tian et al., 2009
determination of left/right symmetry disrupted, abnormal TU + MO3-foxj1a standard conditions Fig. 1,  Fig. 2 from Tian et al., 2009
whole organism curved ventral, abnormal TU + MO3-foxj1a standard conditions Fig. S3 from Tian et al., 2009
heart jogging disrupted, abnormal TU + MO3-foxj1a standard conditions Fig. 1,  Fig. 2 from Tian et al., 2009
heart centered, abnormal TU + MO3-foxj1a standard conditions Fig. 1,  Fig. 2 from Tian et al., 2009
whole organism circling, abnormal TU + MO3-foxj1a standard conditions Fig. S3 from Tian et al., 2009
heart rudiment right side of whole organism anterior-posterior axis, abnormal TU + MO3-foxj1a standard conditions Fig. 1,  Fig. 2 from Tian et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.